The URL can be used to link to this page

363 Atlantic Blvd COMM22-0035 Island Donuts commercial interior buildout permitOWNER:ADDRESS:CITY:STATE:ZIP: NSHORE LLC P.O.BOX 357742 GAINESVILLE FL 32606 COMPANY:ADDRESS:CITY:STATE:ZIP: KANECO CONSTRUCTION, LLC 11330 SAINT JOHNS INDUSTRIAL PARKWAY JACKSONVILLE FL 32246 TYPE OF CONSTRUCTION: REAL ESTATE NUMBER:ZONING:BUILDING USE GROUP:SUBDIVISION: 169730 0000 ATLANTIC BEACH JOB ADDRESS:PERMIT TYPE:DESCRIPTION: VALUE OF WORK: 363 ATLANTIC BLVD 06 COMMERCIAL ALTERATION COMMERCIAL UNIT 6 & 7 - INTERIOR BUILDOUT for ISLAND DONUTS $318751.00 FEES DESCRIPTION ACCOUNT QUANTITY PAID AMOUNT BUILDING PERMIT 455-0000-322-1000 0 $1137.00 BUILDING PLAN CHECK 455-0000-322-1001 0 $568.50 FIRE DEPARTMENT FEE 45500002080800 0 $150.00 STATE DBPR SURCHARGE 455-0000-208-0700 0 $25.58 LIST OF CONDITIONS Roll off container company must be on City approved list . Container cannot be placed on City right-of-way. NOTICE: In addition to the requirements of this permit, there may be additional restrictions applicable to this property that may be found in the public records of this county, and there may be additional permits required from other governmental entities such as water management districts, state agencies, or federal agencies. WARNING TO OWNER: YOUR FAILURE TO RECORD A NOTICE OF COMMENCEMENT MAY RESULT IN YOUR PAYING TWICE FOR IMPROVEMENTS TO YOUR PROPERTY. A NOTICE OF COMMENCEMENT MUST BE RECORDED AND POSTED ON THE JOB SITE BEFORE THE FIRST INSPECTION. IF YOU INTEND TO OBTAIN FINANCING, CONSULT WITH YOUR LENDER OR AN ATTORNEY BEFORE RECORDING YOUR NOTICE OF COMMENCEMENT. MUST CALL INSPECTION PHONE LINE (904) 247-5814 BY 4 PM FOR NEXT DAY INSPECTION. ALL WORK MUST CONFORM TO THE CURRENT 6TH EDITION (2017) OF THE FLORIDA BUILDING CODE, NEC, IPMC, AND CITY OF ATLANTIC BEACH CODE OF ORDINANCES . ALL CONDITIONS OF PERMIT APPLY, PLEASE READ CAREFULLY. 1 of 2Issued Date: 11/8/2022 PERMIT NUMBER COMM22-0035 ISSUED: 11/8/2022 EXPIRES: 5/7/2023 COMMERCIAL PERMIT CITY OF ATLANTIC BEACH 800 SEMINOLE ROAD ATLANTIC BEACH, FL 32233 STATE DCA SURCHARGE 455-0000-208-0600 0 $17.06 ZONING REVIEW COMMERCIAL AND INDUSTRIAL USES 001-0000-329-1003 0 $350.00 TOTAL: $2,248.14 2 of 2Issued Date: 11/8/2022 PERMIT NUMBER COMM22-0035 ISSUED: 11/8/2022 EXPIRES: 5/7/2023 COMMERCIAL PERMIT CITY OF ATLANTIC BEACH 800 SEMINOLE ROAD ATLANTIC BEACH, FL 32233 Final Plumbing Final Electrical Final HVAC CC Final Final Building* Swimming Pool Steel Swimming Pool Safety Electrical Grounding & Bonding Swimming Pool Final (Bldg) Swimming Pool Final (PW) Formed Columns/ Beams* Masonry Cell Fill Structural Steel* OTHER: OTHER: OTHER: OTHER: OTHER: Power Pole Silt Fence Piers/ Stem Walls Underground Plumbing Underground Electric Foundation/ Footing Slab** Retaining Wall Footing Driveway Sewer (Building Dept) Sewer Tap (Utilities Dept) Rough Electric* Rough Plumbing/ Top Out* Rough Mechanical* House Wrap Wall Sheathing Roof Sheathing Tie-down Framing Connections Rough Framing Roofing In Progress Window/Door In-Progress Insulation Ceiling Insulation Wall Exterior Lath Stucco Scratch Coat Exterior Siding In-Progress Brick Flashing & Ties Early Power Gas Rough Gas Final* * When all rough electric, plumbing, mechanical are complete but before any work is covered up. * When all gas piping is complete and wallboard is installed but before gas is attached to any appliance. All outlets must be capped and pipe pressurized at a minimum of 15 lbs. * For new living space: When all construction work including electrical, plumbing, mechanical, exterior finish, grading, required paving and landscaping is complete and the building is ready for occupancy, but before being occupied Additional inspections may apply to your project if your project contains these elements: INSPECTIONS REQUIRED FOR BUILDING PERMITS To verify compliance with building codes, inspections of the work authorized are required at various points of the construction. The following inspections are typically required for residential projects: Date: Initial: Date: Initial: _____________________________________________________ Permit Type ____________________________________________________ Permit No. __________________________________________________________ Job Address ____________________________________________________ Contractor POST THIS CARD WITH PERMITS AND PERMIT DOCUMENTATION IN FRONT OF BUILDING Construction Hours per City Code: 7am—7pm Weekdays; 9am—7pm Weekends Building Department Public Works/Utilities Fire Department Phone: 904-247-5826 Phone: 904-247-5834 Phone: 904-630-4789 Fax: 904-247-5845 Fax: 904-247-5843 Fax: 904-630-4203 * When forms and reinforcing steel, anchor bolts, sleeves and inserts, and all electrical, plumbing and mechanical work is in place, but before concrete is poured. * When all structural steel members are in place and all connections are complete, but before such work is covered or concealed. ** FORM BOARD ELEVATION CERTIFICATE MUST BE ON-SITE FOR SLAB INSPECTION COMM22-0035 PROJECT GAS PIPING NOTES8. PROVIDE NON-CONDUCTION DIELECTRIC UNIONS WHENEVER CONNECTINGDISSIMILAR METALS.9. PROVIDE DIRT LEG, GAS VALVE AND GAS REGULATOR AT EACH PIECE OFEQUIPMENT INSTALLED IN ACCESSIBLE LOCATION WITHIN 36" OF EQUIPMENT. USEVENT-LESS REGULATORS INDOORS WHEN POSSIBLE. ROUTE VENTED REGULATORVENTS TO EXTERIOR.10. GAS PIPING SIZED FOR THE TOTAL CONNECTED LOAD ±100' FROM METER TOFARTHEST CONNECTION, LESS THAN 2 PSI, 0.6 SPECIFIC GRAVITY, 0.5" WATERCOLUMN PRESSURE LOSS.11. GAS PIPING SHALL BE BLACK STEEL, SCHEDULE 40, ROLLED SEAMLESS.12. GAS PIPING CONNECTIONS SHALL BE THREADED EXCEPT FOR PIPING GREATERTHAN 4".13. EXTERIOR GAS PIPING SHALL RECEIVE ONE COAT EACH OF A RUST AND WEATHERRESISTANT PRIMER AND TOP COAT. COORDINATE WITH ARCHITECT FOR COLOR.14. ALL GAS BURNING EQUIPMENT SHALL BE INSTALLED PER NFPA #58, OR NFPA #96(COMMERCIAL COOKING EQUIPMENT).15. COORDINATE NATURAL GAS SERVICE WITH UTILITY COMPANY.16. VALVES ARE NOT PERMITTED FOR GAS PIPING IN CEILING CAVITIES. PROVIDEPROTECTIVE PIPE SLEEVE AT WALL PENETRATION AND SEAL TO PREVENT WATERENTRY.17. GAS METER SHALL BE SECURELY SUPPORTED.1. SANITARY, WASTE AND VENT PIPE AND FITTINGS SHALL BE SOLID CORE DWV SCH 40 PVC, WITH A SOLID CELLULAR CORE, OR COMPOSITEWALL MATERIAL AS SPECIFIED, UNLESS STATED OTHERWISE BY LOCAL CODES AND REGULATIONS; ASTM D2665; ASTM F891; ASTM F1488; CSAB181.2. PROVIDE APPROVED FIRE RATED JACKET WHERE PIPE PASSES THROUGH RETURN AIR PLENUM.2. OFFSET VENT THRU ROOF'S (VTR'S) AS REQUIRED TO PENETRATE ROOF AT LOCATION AT LEAST 10' FROM AIR CONDITIONING UNIT INTAKESAND TERMINATE A MINIMUM OF 12" (INCHES) AWAY FROM ANY VERTICAL SURFACE. COORDINATE EXACT LOCATION OF AIR CONDITIONINGUNITS WITH MECHANICAL CONTRACTOR AND ADJUST AS NECESSARY. EXISTING VTR'S MAY BE RE-USED WHERE SUITABLE.3. REFER TO RISERS FOR PIPE SIZES NOT SHOWN ON PLAN. REFER TO SCHEDULE FOR SANITARY DRAIN, DOMESTIC WATER AND INDIVIDUALVENT CONNECTION SIZES.4. REFER TO ARCHITECTURAL PLANS TO CONFIRM LOCATION OF FIRE RATED WALLS, SMOKE BARRIERS, AND SMOKE PARTITIONS. ALLPENETRATIONS OF RATED WALLS SHALL BE MADE WITH FIRE STOPPING MATERIALS IN ACCORDANCE WITH THE 2020 FLORIDA BUILDING CODEREQUIREMENTS. PENETRATIONS OF ALL FIRE RATED ASSEMBLIES SHALL BE MADE IN ACCORDANCE WITH THE FIRE RATED ASSEMBLY'S ULLISTING, AS APPROVED BY THE AUTHORITY HAVING JURISDICTION.5. SLEEVE ALL FLOOR/WALL PENETRATIONS THAT ARE NOT CORE BORED.6. POTABLE WATER PIPING AND FITTINGS SHALL BE CPVC WITH COMPATIBLE CPVC FITTINGS AND SOLVENT CEMENT, MATERIAL AS SPECIFIED.OR POTABLE WATER PIPING AND FITTINGS SHALL BE TYPE K COPPER BELOW GRADE AND TYPE L COPPER ABOVE GRADE AS SPECIFIED.PROVIDE APPROVED FIRE RATED JACKET WHERE PIPE PASSES THROUGH RETURN AIR PLENUM.7. INSULATE ALL HOT WATER PIPING, AND COLD WATER PIPING IN EXPOSED LOCATIONS, AS SPECIFIED.8. REFER TO WATER HEATER DETAIL FOR EMERGENCY DISCHARGE, DRAIN PAN, AND OTHER PIPING REQUIREMENTS.9. ISOLATION AND SHUTOFF VALVES AND STOP VALVES SHALL BE GATE VALVES, BALL VALVES OR ANGLE STOPS, RATED FOR 150 PSI AT 180°F.REFER TO SPECIFICATIONS.10. PROVIDE WATER HAMMER ARRESTORS FOR ALL FIXTURES IN ACCORDANCE WITH PDI 201 GUIDELINES.11. PROVIDE TRAP PRIMERS FOR ALL FLOOR DRAINS AND/OR FLOOR SINKS. PROVIDE ADA COVERING OVER TRAP PRIMERS INSTALLED UNDERADA LAVATORIES AND SINKS.12. ALL WATER PIPE SHALL BE RUN CONCEALED IN CHASE, WALL, OR ABOVE CEILING EXCEPT IN MECHANICAL ROOMS OR AS OTHERWISENOTED.13. PRIOR TO ORDERING FIXTURES, CONFIRM DIMENSIONAL FIT-UP REQUIREMENTS FOR DWV PIPING LAYOUTS, FRAMING/MILLWORK, FAUCETTRIM HOLES, ETC. AND COORDINATE ANY REQUIRED ADJUSTMENTS FOR PROPER FIT FORM AND FUNCTION OF EACH FIXTURE.14. PROVIDE ALL REQUIRED FITTINGS FOR COMPLETE INSTALLATION OF EACH FIXTURE INCLUDING, BUT NOT LIMITED TO, 3/8" FLEXIBLESUPPLIES, ESCUTCHEON PLATES, STOP VALVES, DRAINS, TRAPS, MOUNTING HARDWARE, ETC. ALL EXPOSED HARDWARE SHALL BE POLISHEDBRASS OR CHROME FINISH.15. INSTALL ALL FIXTURES IN ACCORDANCE WITH MANUFACTURER'S RECOMMENDATIONS, PLUMB AND LEVEL, PROPERLY SECURED ANDSEALED TO WALL OR FLOOR.16. ALL PLUMBING FIXTURES AND MATERIALS SHALL BE INSTALLED IN ACCORDANCE WITH THE 2020 FLORIDA PLUMBING CODE AND ENERGYCONSERVATION CODE, LATEST EDITION ADOPTED BY AUTHORITY HAVING JURISDICTION.17. ALL PLUMBING FIXTURES AND MATERIALS SHALL BE INSTALLED IN ACCORDANCE WITH 2020 FLORIDA ACCESSIBILITY CODE. ENSURESANITARY ROUGH-INS ARE LOCATED TO MAINTAIN ADA CLEARANCES AFTER FIXTURES ARE INSTALLED. REFER TO ARCHITECTURAL SHEETSFOR EXACT DIMENSIONS.18. REVIEW PLANS TO CONFIRM ADEQUATE CHASE AND/OR WALL CAVITY CLEARANCE EXISTS PRIOR TO INITIATION OF WORK.19. ALL PIPING, MATERIALS AND EQUIPMENT ARE NEW UNLESS OTHERWISE NOTED.20. REVIEW BUY AMERICA(N) REQUIREMENTS WITH GENERAL CONTRACTOR. IF RELEVANT TO THIS CONTRACT, CONFIRM ALL EQUIPMENTPROVIDED MEETS THESE REQUIREMENTS, REGARDLESS OF MAKE/MODEL INDICATED ON BASIS OF DESIGN EQUIPMENT SCHEDULES.21. ALL WORK AND MATERIAL SHALL BE PERFORMED AND INSTALLED IN COMPLIANCE WITH THE 2020 FLORIDA BUILDING CODE AND ALLCURRENT AMENDMENTS. NOTHING IN THESE DRAWINGS IS TO BE CONSTRUED TO PERMIT WORK NOT CONFORMING TO THESE CODES.22. ALL PLUMBING WORK SHALL BE INSTALLED TO AVOID INTERFERENCES WITH ELECTRICAL, MECHANICAL AND STRUCTURAL FRAMING.23. EXACT LOCATIONS AND MOUNTING HEIGHTS OF PLUMBING FIXTURES SHALL BE OBTAINED FROM THE ARCHITECTURAL DRAWINGS.24. BEFORE COMMENCEMENT OF WORK, CONTRACTOR SHALL VERIFY THE EXACT LOCATIONS, ELEVATIONS, AND CHARACTERISTICS OF ALLUTILITIES AND PIPING. IMMEDIATELY NOTIFY THE ARCHITECT/ENGINEER OF ANY DISCREPANCIES.25. ALL WASTE AND VENT PIPING SHALL SLOPE AT 1/8" PER FOOT OR 1/4" PER FOOT UNLESS INDICATED OTHERWISE.26. REMOVE ALL FACTORY MARKINGS ON EXPOSED PVC PIPING. USE ACETONE, XYLENE, MEK OR ANOTHER APPROPRIATE SOLVENT.27. FLOOR CLEANOUTS SHALL BE INSTALLED FLUSH TO FINISHED FLOOR, NO DISHING PERMITTED.28. ALL VENT PIPING SHALL BE FULL LINE SIZE IF A WALL CLEAN-OUT IS SHOWN OR AS INDICATED.29. FLOOR DRAIN LINE SIZE AND VENTING IN ACCORDANCE WITH THE 2020 FLORIDA PLUMBING CODE INCLUDING LATEST REVISIONS,COMBINATION WASTE AND VENT SYSTEM.30. ALL VENT PIPING SHALL BE LOCATED WITHIN MASONRY WALLS AND OTHER WALL CONSTRUCTION THAT MAY BE USED TO ENCLOSE THEVENT PIPING. PIPING SHOWN ON DRAWINGS MAY NOT REFLECT THIS INSTALLATION METHOD BECAUSE OF THE DEGREE OF DETAILINCONSISTENT WITH 1/8" PLANS. IF PIPING CANNOT BE INSTALLED WITHIN THESE STRUCTURES, APPROVAL OF THE ENGINEER OF ANOTHERINSTALLATION METHOD IS REQUIRED. ALL EXPOSED VENT PIPING SHALL BE ATTACHED TO WALL NO FURTHER THAN 3" AWAY.31. PLUMING FIXTURE DESCRIPTION SHALL TAKE PRECEDENCE WHEN EXISTS A CONFLICT WITH THE DESCRIPTION AND MODEL NUMBER.32. PLUMBING CONTRACTOR SHALL PROVIDE A PRESSURE REDUCING VALVE (PRV) WHERE WATER MAIN ENTERS BUILDING IF PRESSUREEXCEEDS 80 PSI. SET PRESSURE REDUCING VALVE TO 75 PSI.33. WHILE EVERY ATTEMPT HAS BEEN MADE IN THE PREPARATION TO THESE PLANS TO AVOID MISTAKES, THE DESIGNER AND COMPANYCANNOT GUARANTEE AGAINST ERROR OR UNFORESEEN FIELD CONDITIONS. THE CONTRACTOR OR BUILDER MUST CHECK ALL DIMENSIONSAND DETAILS AND REPORT ANY DISCREPANCIES.34. CONTRACTOR MUST CHECK EQUIPMENT NOT IN CONTRACT SO THAT THE SERVICE REQUIREMENTS ARE CORRECTLY TYPED, ADEQUATELYSIZED, AND ROUGHED-IN PROPERLY SO AS TO MINIMIZE THE AMOUNT OF MATERIALS AND FITTINGS NEEDED FOR FINAL HOOK-UP, RESULTINGIN A NEAT AND ORDERLY LOOKING INSTALLATION.35. COORDINATE WITH GENERAL CONTRACTOR AND ALL OTHER DISCIPLINES FOR CONNECTION REQUIREMENTS AND RUN LOCATIONS TOPREVENT CONFLICTS.36. LANDLORD TO APPROVE ALL ROOF PENETRATIONS. ALL ROOF WORK MUST BE BY LANDLORD'S APPROVED ROOFER.PLUMBING LEGENDPROJECT GENERAL NOTESABBREVIATIONSPIPINGPROJECT PIPING NOTES1. PROVIDE TRAPEZE PIPE HANGERS FOR PIPES 3 OR MORE. DOUBLE NUT U-BOLTS EVERY THIRD HANGER. U-BOLT SHALL BE LOOSELYFASTENED. INTENT IS NOT TO BIND OR HOLD PIPE, BUT ONLY TO PROVIDE LATERAL SEPARATION.2. PROVIDE 1" X 1" X 1/8" ANGLE WELDED TO BOTH SIDES OF PIPE OF BAR JOIST IF PIPE HANGAR IS MORE THAN 6" AWAY FROM PANEL POINTS.3. PROVIDE WATER HAMMER ARRESTORS FOR ALL GANG TOILET AREAS OR ANY OTHER SINGLE OR MULTIPLE WATER USING DEVICE.4. FASTEN ALL INSULATION PIPE SHIELDS TO PIPE INSULATION WITH ADHESIVE.5. ALL PIPE SUPPORT SYSTEMS SHALL NOT CRUSH THE INSULATION WHEN RESTING UPON THE SUPPORT. THE USE OF METAL SADDLES ISNECESSARY WHEN THE WEIGHT OF PIPE EXCEEDS THE WEIGHT SUPPORT LIMIT OF THE INSULATION.6. PIPE SIZES MAY BE SHOWN FOR THE SAME PIPING ON MORE THAN ONE PLAN. IN CASE OF PIPE SIZE DISCREPANCY, THE LARGER PIPE SIZESHALL BE CONSIDERED CORRECT DURING THE BIDDING AND DURING CONSTRUCTION UNLESS SPECIFICALLY APPROVED BY THEARCHITECT/ENGINEER OTHERWISE.7. PROVIDE SHUT-OFF VALVES FOR BOTH HOT AND COLD DOMESTIC WATER AT ALL RESTROOM LOCATIONS AND HEAT TRAPS FOR WATERHEATERS.8. PROVIDE 1" INSULATION ON HOT WATER PIPING. REFER TO TABLE C403.2.10 OF THE 2020 FLORIDA ENERGY CONSERVATION CODE.9. PIPE PENETRATIONS THROUGH FIRE RATED WALLS AND FLOORS SHALL BE INSULATED AND HAVE SPACE SEALED WITH FIRE STOP MATERIAL.10. PROVIDE A POSI-SET SYSTEM GAS CONNECTION SYSTEM FOR ALL GAS APPLIANCES.NOTE:NO PLUMBING, GAS, MECHANICAL OR ELECTRICAL CONNECTIONS OR INSTALLATIONSSHALL BE MADE UNTIL THE GENERAL CONTRACTOR, SUBCONTRACTOR ANDOWNER/TENANT HAVE FIELD VERIFIED ALL EQUIPMENT REQUIREMENTS WITHEQUIPMENT SUPPLIER.NTS NOT TO SCALEWCOSRCOOGVTRFCOCOTYP.WHAEWCHBHWCWCLEAN-OUT ON GRADESANITARY RISERWALL CLEAN-OUTCLEAN-OUTFLOOR CLEAN-OUTVENT THRU ROOFELECTRIC WATER COOLERTYPICALWATER HAMMER ARRESTORCOLD WATER LINEHOT WATER LINEHOSE BIBBFLOOR DRAINFDFS FLOOR SINKAFF ABOVE FINISHED FLOORHWP HOT WATER RECIRCULATION PUMPCND CONDENSATE DRAINSAN SANITARY LINEV VENT LINEAS AQUASTATWM WATER METERABBREVIATIONSCFH CUBIC FEET PER HOURMBH THOUSAND BTU'S PER HOURPSI POUNDS PER SQUARE INCHWC WATER COLUMNWR WATER RISERET THERMAL EXPANSION TANKBTU BRITISH THERMAL UNITAHJ AUTHORITIES HAVING JURISDICTIONTMV TEMPERATURE MIXING VALVEGI GREASE INTERCEPTORLINT INTERCEPTORLIGPF GALLONS PER FLUSHGPM GALLONS PER MINUTETPV TRAP PRIMER VALVEWSV WASTE STACK VENTCA COMPRESSED AIRVS VENT STACKWS WASTE STACKAC AIR COMPRESSORBTS BARRIER TYPE SEAL-TRAP PRIMEREWH ELECTRIC WATER HEATERFUNNEL FLOOR DRAINFNDGR GAS REGULATORGWH GAS WATER HEATERHD HUB DRAININSTANTANEOUS WATER HEATERIWHICE MAKER VALVE BOXIVBPRV PRESSURE REDUCING VALVERVB REFRIGERATOR VALVE BOXRD ROOF DRAINSD SHOWER DRAINSP SUMP PUMPTD TRENCH DRAINWVB CLOTHES WASHER VALVE BOXWALL HYDRANTHYYH YARD HYDRANTPOINT OF CONNECTION TOEXISTINGPOINT OF DISCONNECTIONFROM EXISTINGFORCE MAINFMRL RAIN LEADERELBOW (PLAN, UP, DOWN)SHUT-OFF VALVES (GATE/BALL VALVES)BRANCH CONNECTIONS (TOP, BOTTOM, SIDE)TEE (PLAN, UP, DOWN)TRAP, PLAN VIEWHOT WATERSANITARYVENTCOLD WATERSTRAINERGASGASNATURAL GAS/PROPANEEXISTING SANITARY (FADED)EXISTING COLD WATER (FADED)EXISTING HOT WATER (FADED)EXISTING HOT WATER RETURN (FADED)CAP FOR FUTURE CONNECTIONGAS BALL OR PLUG VALVEDIRECTION OF FLOWCIRCUIT BALANCING VALVE WITH MEMORY STOPPRESSURE REDUCING VALVEUNIONCLEANOUT IN FLOORCLEANOUT ON END OF PIPEHOSE BIBBFLOOR DRAIN, FLOOR SINKGLOBE VALVEEXISTING VENT (FADED)AACOMPRESSED AIRTEMPERED WATER MIXING VALVEDEMOLITIONREDUCED PRESSURE BACKFLOW PREVENTERHOT WATER RECIRCULATION PUMPPCHECK VALVEAAV AIR ADMITTANCE VALVEHOT WATER RETURN LINEHWRGW GREASE WASTE LINEWATER METERMCONTINUATIONBFG BELOW FINISHED GRADEBFF BELOW FINISHED FLOORECO EXTERIOR CLEAN-OUTGAS GAS LINE1. GAS PIPING SHALL BE INSTALLED IN ACCORDANCE WITH THE LATEST ISSUE OF THEINTERNATIONAL CODE COUNCIL OR STATE FUEL GAS CODE AND NFPA STANDARD NO.54 OR NFPA-58 WHICH APPLY.2. GAS PIPING SHALL BE TESTED IN ACCORDANCE WITH THE PROCEDURESDESCRIBED IN NFPA NO. 54. ANY OTHER TEST AS REQUIRED BY THE LOCAL GASINSPECTION DEPARTMENT OR GAS COMPANY SHALL ALSO BE PREFORMED.3. MINIMUM GAS PIPING SIZING SHALL BE 3/4".4. GAS PIPING COLOR/LABELS: EXTERIOR: LABEL ALL GAS PIPING "GAS/PRESSURE" ON PIPE AT 5'-0" CENTERS ANDCOLOR; ON ROOF PAINT WITH TWO COATS OF YELLOW ENAMEL, ON VERTICAL WALLSPAINT TO MATCH WALL COLOR. INTERIOR: LABEL ALL GAS PIPING "GAS/PRESSURE", SPACING AND COLOR PERANSI/ASME A113.1 CODE REQUIREMENTS.5. GAS PIPING SUPPORTS: EXTERIOR: PIPING ROUTED ON ROOF SHALL BE STRAPPED TO MANUFACTUREDSUPPORTS "QUICK-BLOCK" OR EQUAL. GAS SUPPORTS SPACED PER NFPA 54 7.2.5.2. INTERIOR: PIPING TO BE SUPPORTED BY CLEVIS HANGERS WITH THREADED RODOR UNI-STRUT SYSTEM. GAS SUPPORTS SPACED PER NFPA 54 7.2.5.2.6. GAS VALVES SHALL BE ANSI/CSA APPROVED, 125 PSI RATED, 2 PIECE, FULL PORT,BALL VALVES WITH BRASS BODY AND BALL. PROVIDE WITH LEVER HANDLE.7. PROVIDE UNIONS, FLANGES, OR COUPLINGS AT CONNECTION TO ALL VALVES ANDEQUIPMENT. DO NOT USE DIRECT WELDED OR THREADED CONNECTIONS TO VALVES,EQUIPMENT OR OTHER APPARATUS.CL CENTER LINEDN DOWNEX EXISTINGGC GENERAL CONTRACTORHI HAIR INTERCEPTORNIC NOT IN CONTRACTOW OIL WASTE SANITARY LINEOWS OIL WASTE SEPARATORTW TEMPERED WATER LINEVB VACUUM BREAKERPROJECT DEMOLITION NOTES1. REMOVE EXISTING PLUMBING FIXTURES, EQUIPMENT, AND EQUIPMENT PADS TOTHE EXTENT INDICATED ON THE PLUMBING AND ARCHITECTURAL DEMOLITIONDRAWINGS.2. REMOVE EXISTING WATER PIPING TO THE EXTENT INDICATED ON THE DRAWINGS.POINTS OF DISCONNECTION/RECONNECTION ON DRAWINGS ARE BASED BESTAVAILABLE INFORMATION AND SHALL BE FIELD LOCATED AND ADJUSTEDACCORDINGLY. UNLESS OTHERWISE INDICATED, INACCESSIBLE EXISTINGUNDER-SLAB PIPING NOT INTERFERING WITH NEW CONSTRUCTION MAY BEABANDONED IN PLACE AFTER COMPLETELY DISCONNECTING FROM NEW SYSTEM,DRAINING, CUTTING AND CAPPING BELOW GRADE.3. REMOVE EXISTING SANITARY, WASTE, & VENT PIPING SYSTEMS TO THE EXTENTINDICATED ON THE DRAWINGS. POINTS OF DISCONNECTION/RECONNECTION ONPLANS ARE BASED BEST AVAILABLE INFORMATION AND SHALL BE FIELD LOCATEDAND ADJUSTED ACCORDINGLY. INACCESSIBLE EXISTING UNDER-SLAB PIPING NOTINTERFERING WITH NEW CONSTRUCTION MAY BE ABANDONED IN PLACE AFTERCOMPLETELY DISCONNECTING FROM NEW SYSTEM, DRAINING, CUTTING ANDCAPPING BELOW GRADE. EXISTING VTR'S OF REQUIRED SIZE AND ACCEPTABLECONDITION MAY BE RE-USED.4. EXISTING PIPING TO BE RE-USED IS SHOWN FADED.5. RECOVER ALL REFRIGERANT IN ACCORDANCE WITH ALL FEDERAL, STATE ANDLOCAL REQUIREMENTS.6. PROPERLY DISPOSE OF ALL REMOVED MATERIAL OFFSITE.7. ALL EQUIPMENT BEING REUSED SHALL BE INSPECTED FOR PROPER OPERATIONAND REASONABLE CONDITION AND SHALL BE PRESSURE TESTED WITH THE NEWSYSTEM. ALL PIPING BEING REUSED SHALL BE VISUALLY INSPECTED FORREASONABLE CONDITION, SLOPE AND INVERT, AS APPLICABLE; AND SHALL BEFLUSHED AND PRESSURE TESTED.8. EXISTING PLUMBING SYSTEM, WHERE INDICATED, ARE BASED ON BEST AVAILABLEINFORMATION. CONTRACTOR SHALL VISIT SITE PRIOR TO BIDDING AND FIELDCONFIRM EXTENT OF DEMOLITION, EXISTING INVERTS, ETC. CONTRACTOR SHALLCONFIRM ALL EXISTING CONDITIONS AS DEMOLITION OCCURS. REFER TO ORIGINALCONSTRUCTION DRAWINGS WHERE AVAILABLE FOR ADDITIONAL INFORMATION OFEXISTING CONDITIONS.FW FILTERED WATER LINE18. WATER HEATERS SUPPLYING KITCHENS SHALL BE N.S.F. APPROVED.19. ELECTRONIC IGNITION CONTROLS (120V/1/60); COORDINATE WITHELECTRICAL CONTRACTOR.20. INSTALL WATER HEATER PER MANUFACTURER'S REQUIREMENTS.COORDINATE ALL CONNECTION POINTS IN THE FIELD.21. EACH ABOVE-GROUND PORTION OF A GAS PIPING SYSTEM OTHER THANCORRUGATED STAINLESS STEEL TUBING (CSST) THAT IS LIKELY TO BECOMEENERGIZED SHALL BE ELECTRICALLY CONTINUOUS AND BONDED TO ANEFFECTIVE GROUND-FAULT CURRENT PATH. GAS PIPING OTHER THAN CSSTSHALL BE CONSIDERED TO BE BONDED WHERE IT IS CONNECTED TOAPPLIANCES THAT ARE CONNECTED TO EQUIPMENT GROUNDINGCONDUCTOR OF THE CIRCUIT SUPPLYING THAT APPLIANCE. CSST GASPIPING SYSTEMS SHALL BE BONDED TO THE ELECTRICAL SERVICEGROUNDING ELECTRODE SYSTEM AT THE POINT WHERE THE GAS SERVICEENTERS THE BUILDING. THE BONDING JUMPER SHALL NOT BE SMALLERTHAN 6 AWG COPPER WIRE OR EQUIVALENT.22, THE INSTALLING SUBCONTRACTOR SHALL BE LICENSED BY THE STATEOF FLORIDA FOR THE INSTALLATION OF GAS PIPING.23. ALL GAS EQUIPMENT SHALL BE AGA APPROVED.24. COORDINATE ROUTING OF GAS PIPING WITH CONSTRUCTION MANAGER.ASME PRESSURE/TEMP RELIEF VALVEHOT WATER RETURNGREASE WASTEFILTERED COLD WATERWATER HEATER RELIEFBUTTERFLY VALVEPLUMBING LEGEND AND PROJECT NOTES P-1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING SCHEDULES P-2SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING SCHEDULES P-2.1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SEATINGAREA101OFFICE103E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105.PLUMBING PLANS P-3SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"0 2' 4' 8'SCALE:1/4"=1'-0"SANITARY WASTE PLAN E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.SEATINGAREA101OFFICE103ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105CHM CHMCHM CHMCHM DOMESTIC WATER PLAN P-4SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"0 2' 4' 8'SCALE:1/4"=1'-0"DOMESTIC WATER PLAN E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.SEATINGAREA101OFFICE103ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105PLUMBING GAS PLAN AND GAS RISER P-5SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"0 2' 4' 8'SCALE:1/4"=1'-0"PLUMBING GAS PLANSCALE: N.T.S.GAS RISER DIAGRAM 1'-6" MIN.TO 2'-0"4" MIN.4" MIN.3" MIN.1'-6"1'-6" MIN.TO 2'-0"P-6SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SCALE: N.T.S.WALL CLEANOUT DETAIL (WCO)SCALE: N.T.S.FLOOR SINK DETAIL (FS)PLUMBING DETAILS SCALE: N.T.S.FLOOR DRAIN DETAIL (FD)SCALE: N.T.S.GAS PIPE SLEEVE THRU WALL DETAILSCALE: N.T.S.TYPICAL PIPE SLEEVE THRU WALL DETAILSCALE: N.T.S.GAS APPLIANCE PIPE SLEEVE DETAILSCALE: N.T.S.HUB DRAIN DETAIL (HD)SCALE: N.T.S.TRENCH DETAIL P-6.1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING DETAILS SCALE: N.T.S.EXTERIOR TANKLESS GAS WATER HEATER DETAIL (IGWH)SCALE: N.T.S.ANTI-SCALD DEVICE DETAIL (TMV-P)SCALE: N.T.S.TRAP PRIMER DETAIL (TPV)SCALE: N.T.S.WATER HAMMER ARRESTOR DETAILSCALE: N.T.S.GREASE INTERCEPTOR SPECIFICATION .P-6SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SANITARY RISERSSCALE: N.T.S.SANITARY RISER - RESTROOMSSCALE: N.T.S.SANITARY RISER - RESTAURANT PROJECT GAS PIPING NOTES8. PROVIDE NON-CONDUCTION DIELECTRIC UNIONS WHENEVER CONNECTINGDISSIMILAR METALS.9. PROVIDE DIRT LEG, GAS VALVE AND GAS REGULATOR AT EACH PIECE OFEQUIPMENT INSTALLED IN ACCESSIBLE LOCATION WITHIN 36" OF EQUIPMENT. USEVENT-LESS REGULATORS INDOORS WHEN POSSIBLE. ROUTE VENTED REGULATORVENTS TO EXTERIOR.10. GAS PIPING SIZED FOR THE TOTAL CONNECTED LOAD ±100' FROM METER TOFARTHEST CONNECTION, LESS THAN 2 PSI, 0.6 SPECIFIC GRAVITY, 0.5" WATERCOLUMN PRESSURE LOSS.11. GAS PIPING SHALL BE BLACK STEEL, SCHEDULE 40, ROLLED SEAMLESS.12. GAS PIPING CONNECTIONS SHALL BE THREADED EXCEPT FOR PIPING GREATERTHAN 4".13. EXTERIOR GAS PIPING SHALL RECEIVE ONE COAT EACH OF A RUST AND WEATHERRESISTANT PRIMER AND TOP COAT. COORDINATE WITH ARCHITECT FOR COLOR.14. ALL GAS BURNING EQUIPMENT SHALL BE INSTALLED PER NFPA #58, OR NFPA #96(COMMERCIAL COOKING EQUIPMENT).15. COORDINATE NATURAL GAS SERVICE WITH UTILITY COMPANY.16. VALVES ARE NOT PERMITTED FOR GAS PIPING IN CEILING CAVITIES. PROVIDEPROTECTIVE PIPE SLEEVE AT WALL PENETRATION AND SEAL TO PREVENT WATERENTRY.17. GAS METER SHALL BE SECURELY SUPPORTED.1. SANITARY, WASTE AND VENT PIPE AND FITTINGS SHALL BE SOLID CORE DWV SCH 40 PVC, WITH A SOLID CELLULAR CORE, OR COMPOSITEWALL MATERIAL AS SPECIFIED, UNLESS STATED OTHERWISE BY LOCAL CODES AND REGULATIONS; ASTM D2665; ASTM F891; ASTM F1488; CSAB181.2. PROVIDE APPROVED FIRE RATED JACKET WHERE PIPE PASSES THROUGH RETURN AIR PLENUM.2. OFFSET VENT THRU ROOF'S (VTR'S) AS REQUIRED TO PENETRATE ROOF AT LOCATION AT LEAST 10' FROM AIR CONDITIONING UNIT INTAKESAND TERMINATE A MINIMUM OF 12" (INCHES) AWAY FROM ANY VERTICAL SURFACE. COORDINATE EXACT LOCATION OF AIR CONDITIONINGUNITS WITH MECHANICAL CONTRACTOR AND ADJUST AS NECESSARY. EXISTING VTR'S MAY BE RE-USED WHERE SUITABLE.3. REFER TO RISERS FOR PIPE SIZES NOT SHOWN ON PLAN. REFER TO SCHEDULE FOR SANITARY DRAIN, DOMESTIC WATER AND INDIVIDUALVENT CONNECTION SIZES.4. REFER TO ARCHITECTURAL PLANS TO CONFIRM LOCATION OF FIRE RATED WALLS, SMOKE BARRIERS, AND SMOKE PARTITIONS. ALLPENETRATIONS OF RATED WALLS SHALL BE MADE WITH FIRE STOPPING MATERIALS IN ACCORDANCE WITH THE 2020 FLORIDA BUILDING CODEREQUIREMENTS. PENETRATIONS OF ALL FIRE RATED ASSEMBLIES SHALL BE MADE IN ACCORDANCE WITH THE FIRE RATED ASSEMBLY'S ULLISTING, AS APPROVED BY THE AUTHORITY HAVING JURISDICTION.5. SLEEVE ALL FLOOR/WALL PENETRATIONS THAT ARE NOT CORE BORED.6. POTABLE WATER PIPING AND FITTINGS SHALL BE CPVC WITH COMPATIBLE CPVC FITTINGS AND SOLVENT CEMENT, MATERIAL AS SPECIFIED.OR POTABLE WATER PIPING AND FITTINGS SHALL BE TYPE K COPPER BELOW GRADE AND TYPE L COPPER ABOVE GRADE AS SPECIFIED.PROVIDE APPROVED FIRE RATED JACKET WHERE PIPE PASSES THROUGH RETURN AIR PLENUM.7. INSULATE ALL HOT WATER PIPING, AND COLD WATER PIPING IN EXPOSED LOCATIONS, AS SPECIFIED.8. REFER TO WATER HEATER DETAIL FOR EMERGENCY DISCHARGE, DRAIN PAN, AND OTHER PIPING REQUIREMENTS.9. ISOLATION AND SHUTOFF VALVES AND STOP VALVES SHALL BE GATE VALVES, BALL VALVES OR ANGLE STOPS, RATED FOR 150 PSI AT 180°F.REFER TO SPECIFICATIONS.10. PROVIDE WATER HAMMER ARRESTORS FOR ALL FIXTURES IN ACCORDANCE WITH PDI 201 GUIDELINES.11. PROVIDE TRAP PRIMERS FOR ALL FLOOR DRAINS AND/OR FLOOR SINKS. PROVIDE ADA COVERING OVER TRAP PRIMERS INSTALLED UNDERADA LAVATORIES AND SINKS.12. ALL WATER PIPE SHALL BE RUN CONCEALED IN CHASE, WALL, OR ABOVE CEILING EXCEPT IN MECHANICAL ROOMS OR AS OTHERWISENOTED.13. PRIOR TO ORDERING FIXTURES, CONFIRM DIMENSIONAL FIT-UP REQUIREMENTS FOR DWV PIPING LAYOUTS, FRAMING/MILLWORK, FAUCETTRIM HOLES, ETC. AND COORDINATE ANY REQUIRED ADJUSTMENTS FOR PROPER FIT FORM AND FUNCTION OF EACH FIXTURE.14. PROVIDE ALL REQUIRED FITTINGS FOR COMPLETE INSTALLATION OF EACH FIXTURE INCLUDING, BUT NOT LIMITED TO, 3/8" FLEXIBLESUPPLIES, ESCUTCHEON PLATES, STOP VALVES, DRAINS, TRAPS, MOUNTING HARDWARE, ETC. ALL EXPOSED HARDWARE SHALL BE POLISHEDBRASS OR CHROME FINISH.15. INSTALL ALL FIXTURES IN ACCORDANCE WITH MANUFACTURER'S RECOMMENDATIONS, PLUMB AND LEVEL, PROPERLY SECURED ANDSEALED TO WALL OR FLOOR.16. ALL PLUMBING FIXTURES AND MATERIALS SHALL BE INSTALLED IN ACCORDANCE WITH THE 2020 FLORIDA PLUMBING CODE AND ENERGYCONSERVATION CODE, LATEST EDITION ADOPTED BY AUTHORITY HAVING JURISDICTION.17. ALL PLUMBING FIXTURES AND MATERIALS SHALL BE INSTALLED IN ACCORDANCE WITH 2020 FLORIDA ACCESSIBILITY CODE. ENSURESANITARY ROUGH-INS ARE LOCATED TO MAINTAIN ADA CLEARANCES AFTER FIXTURES ARE INSTALLED. REFER TO ARCHITECTURAL SHEETSFOR EXACT DIMENSIONS.18. REVIEW PLANS TO CONFIRM ADEQUATE CHASE AND/OR WALL CAVITY CLEARANCE EXISTS PRIOR TO INITIATION OF WORK.19. ALL PIPING, MATERIALS AND EQUIPMENT ARE NEW UNLESS OTHERWISE NOTED.20. REVIEW BUY AMERICA(N) REQUIREMENTS WITH GENERAL CONTRACTOR. IF RELEVANT TO THIS CONTRACT, CONFIRM ALL EQUIPMENTPROVIDED MEETS THESE REQUIREMENTS, REGARDLESS OF MAKE/MODEL INDICATED ON BASIS OF DESIGN EQUIPMENT SCHEDULES.21. ALL WORK AND MATERIAL SHALL BE PERFORMED AND INSTALLED IN COMPLIANCE WITH THE 2020 FLORIDA BUILDING CODE AND ALLCURRENT AMENDMENTS. NOTHING IN THESE DRAWINGS IS TO BE CONSTRUED TO PERMIT WORK NOT CONFORMING TO THESE CODES.22. ALL PLUMBING WORK SHALL BE INSTALLED TO AVOID INTERFERENCES WITH ELECTRICAL, MECHANICAL AND STRUCTURAL FRAMING.23. EXACT LOCATIONS AND MOUNTING HEIGHTS OF PLUMBING FIXTURES SHALL BE OBTAINED FROM THE ARCHITECTURAL DRAWINGS.24. BEFORE COMMENCEMENT OF WORK, CONTRACTOR SHALL VERIFY THE EXACT LOCATIONS, ELEVATIONS, AND CHARACTERISTICS OF ALLUTILITIES AND PIPING. IMMEDIATELY NOTIFY THE ARCHITECT/ENGINEER OF ANY DISCREPANCIES.25. ALL WASTE AND VENT PIPING SHALL SLOPE AT 1/8" PER FOOT OR 1/4" PER FOOT UNLESS INDICATED OTHERWISE.26. REMOVE ALL FACTORY MARKINGS ON EXPOSED PVC PIPING. USE ACETONE, XYLENE, MEK OR ANOTHER APPROPRIATE SOLVENT.27. FLOOR CLEANOUTS SHALL BE INSTALLED FLUSH TO FINISHED FLOOR, NO DISHING PERMITTED.28. ALL VENT PIPING SHALL BE FULL LINE SIZE IF A WALL CLEAN-OUT IS SHOWN OR AS INDICATED.29. FLOOR DRAIN LINE SIZE AND VENTING IN ACCORDANCE WITH THE 2020 FLORIDA PLUMBING CODE INCLUDING LATEST REVISIONS,COMBINATION WASTE AND VENT SYSTEM.30. ALL VENT PIPING SHALL BE LOCATED WITHIN MASONRY WALLS AND OTHER WALL CONSTRUCTION THAT MAY BE USED TO ENCLOSE THEVENT PIPING. PIPING SHOWN ON DRAWINGS MAY NOT REFLECT THIS INSTALLATION METHOD BECAUSE OF THE DEGREE OF DETAILINCONSISTENT WITH 1/8" PLANS. IF PIPING CANNOT BE INSTALLED WITHIN THESE STRUCTURES, APPROVAL OF THE ENGINEER OF ANOTHERINSTALLATION METHOD IS REQUIRED. ALL EXPOSED VENT PIPING SHALL BE ATTACHED TO WALL NO FURTHER THAN 3" AWAY.31. PLUMING FIXTURE DESCRIPTION SHALL TAKE PRECEDENCE WHEN EXISTS A CONFLICT WITH THE DESCRIPTION AND MODEL NUMBER.32. PLUMBING CONTRACTOR SHALL PROVIDE A PRESSURE REDUCING VALVE (PRV) WHERE WATER MAIN ENTERS BUILDING IF PRESSUREEXCEEDS 80 PSI. SET PRESSURE REDUCING VALVE TO 75 PSI.33. WHILE EVERY ATTEMPT HAS BEEN MADE IN THE PREPARATION TO THESE PLANS TO AVOID MISTAKES, THE DESIGNER AND COMPANYCANNOT GUARANTEE AGAINST ERROR OR UNFORESEEN FIELD CONDITIONS. THE CONTRACTOR OR BUILDER MUST CHECK ALL DIMENSIONSAND DETAILS AND REPORT ANY DISCREPANCIES.34. CONTRACTOR MUST CHECK EQUIPMENT NOT IN CONTRACT SO THAT THE SERVICE REQUIREMENTS ARE CORRECTLY TYPED, ADEQUATELYSIZED, AND ROUGHED-IN PROPERLY SO AS TO MINIMIZE THE AMOUNT OF MATERIALS AND FITTINGS NEEDED FOR FINAL HOOK-UP, RESULTINGIN A NEAT AND ORDERLY LOOKING INSTALLATION.35. COORDINATE WITH GENERAL CONTRACTOR AND ALL OTHER DISCIPLINES FOR CONNECTION REQUIREMENTS AND RUN LOCATIONS TOPREVENT CONFLICTS.36. LANDLORD TO APPROVE ALL ROOF PENETRATIONS. ALL ROOF WORK MUST BE BY LANDLORD'S APPROVED ROOFER.PLUMBING LEGENDPROJECT GENERAL NOTESABBREVIATIONSPIPINGPROJECT PIPING NOTES1. PROVIDE TRAPEZE PIPE HANGERS FOR PIPES 3 OR MORE. DOUBLE NUT U-BOLTS EVERY THIRD HANGER. U-BOLT SHALL BE LOOSELYFASTENED. INTENT IS NOT TO BIND OR HOLD PIPE, BUT ONLY TO PROVIDE LATERAL SEPARATION.2. PROVIDE 1" X 1" X 1/8" ANGLE WELDED TO BOTH SIDES OF PIPE OF BAR JOIST IF PIPE HANGAR IS MORE THAN 6" AWAY FROM PANEL POINTS.3. PROVIDE WATER HAMMER ARRESTORS FOR ALL GANG TOILET AREAS OR ANY OTHER SINGLE OR MULTIPLE WATER USING DEVICE.4. FASTEN ALL INSULATION PIPE SHIELDS TO PIPE INSULATION WITH ADHESIVE.5. ALL PIPE SUPPORT SYSTEMS SHALL NOT CRUSH THE INSULATION WHEN RESTING UPON THE SUPPORT. THE USE OF METAL SADDLES ISNECESSARY WHEN THE WEIGHT OF PIPE EXCEEDS THE WEIGHT SUPPORT LIMIT OF THE INSULATION.6. PIPE SIZES MAY BE SHOWN FOR THE SAME PIPING ON MORE THAN ONE PLAN. IN CASE OF PIPE SIZE DISCREPANCY, THE LARGER PIPE SIZESHALL BE CONSIDERED CORRECT DURING THE BIDDING AND DURING CONSTRUCTION UNLESS SPECIFICALLY APPROVED BY THEARCHITECT/ENGINEER OTHERWISE.7. PROVIDE SHUT-OFF VALVES FOR BOTH HOT AND COLD DOMESTIC WATER AT ALL RESTROOM LOCATIONS AND HEAT TRAPS FOR WATERHEATERS.8. PROVIDE 1" INSULATION ON HOT WATER PIPING. REFER TO TABLE C403.2.10 OF THE 2020 FLORIDA ENERGY CONSERVATION CODE.9. PIPE PENETRATIONS THROUGH FIRE RATED WALLS AND FLOORS SHALL BE INSULATED AND HAVE SPACE SEALED WITH FIRE STOP MATERIAL.10. PROVIDE A POSI-SET SYSTEM GAS CONNECTION SYSTEM FOR ALL GAS APPLIANCES.NOTE:NO PLUMBING, GAS, MECHANICAL OR ELECTRICAL CONNECTIONS OR INSTALLATIONSSHALL BE MADE UNTIL THE GENERAL CONTRACTOR, SUBCONTRACTOR ANDOWNER/TENANT HAVE FIELD VERIFIED ALL EQUIPMENT REQUIREMENTS WITHEQUIPMENT SUPPLIER.NTSNOT TO SCALEWCOSRCOOGVTRFCOCOTYP.WHAEWCHBHWCWCLEAN-OUT ON GRADESANITARY RISERWALL CLEAN-OUTCLEAN-OUTFLOOR CLEAN-OUTVENT THRU ROOFELECTRIC WATER COOLERTYPICALWATER HAMMER ARRESTORCOLD WATER LINEHOT WATER LINEHOSE BIBBFLOOR DRAINFDFSFLOOR SINKAFFABOVE FINISHED FLOORHWPHOT WATER RECIRCULATION PUMPCNDCONDENSATE DRAINSANSANITARY LINEVVENT LINEASAQUASTATWMWATER METERABBREVIATIONSCFHCUBIC FEET PER HOURMBHTHOUSAND BTU'S PER HOURPSIPOUNDS PER SQUARE INCHWCWATER COLUMNWRWATER RISERETTHERMAL EXPANSION TANKBTUBRITISH THERMAL UNITAHJAUTHORITIES HAVING JURISDICTIONTMVTEMPERATURE MIXING VALVEGIGREASE INTERCEPTORLINT INTERCEPTORLIGPFGALLONS PER FLUSHGPMGALLONS PER MINUTETPVTRAP PRIMER VALVEWSVWASTE STACK VENTCACOMPRESSED AIRVSVENT STACKWSWASTE STACKACAIR COMPRESSORBTSBARRIER TYPE SEAL-TRAP PRIMEREWHELECTRIC WATER HEATERFUNNEL FLOOR DRAINFNDGRGAS REGULATORGWHGAS WATER HEATERHDHUB DRAININSTANTANEOUS WATER HEATERIWHICE MAKER VALVE BOXIVBPRVPRESSURE REDUCING VALVERVBREFRIGERATOR VALVE BOXRDROOF DRAINSDSHOWER DRAINSPSUMP PUMPTDTRENCH DRAINWVBCLOTHES WASHER VALVE BOXWALL HYDRANTHYYHYARD HYDRANTPOINT OF CONNECTION TOEXISTINGPOINT OF DISCONNECTIONFROM EXISTINGFORCE MAINFMRLRAIN LEADERELBOW (PLAN, UP, DOWN)SHUT-OFF VALVES (GATE/BALL VALVES)BRANCH CONNECTIONS (TOP, BOTTOM, SIDE)TEE (PLAN, UP, DOWN)TRAP, PLAN VIEWHOT WATERSANITARYVENTCOLD WATERSTRAINERGASGASNATURAL GAS/PROPANEEXISTING SANITARY (FADED)EXISTING COLD WATER (FADED)EXISTING HOT WATER (FADED)EXISTING HOT WATER RETURN (FADED)CAP FOR FUTURE CONNECTIONGAS BALL OR PLUG VALVEDIRECTION OF FLOWCIRCUIT BALANCING VALVE WITH MEMORY STOPPRESSURE REDUCING VALVEUNIONCLEANOUT IN FLOORCLEANOUT ON END OF PIPEHOSE BIBBFLOOR DRAIN, FLOOR SINKGLOBE VALVEEXISTING VENT (FADED)AACOMPRESSED AIRTEMPERED WATER MIXING VALVEDEMOLITIONREDUCED PRESSURE BACKFLOW PREVENTERHOT WATER RECIRCULATION PUMPPCHECK VALVEAAVAIR ADMITTANCE VALVEHOT WATER RETURN LINEHWRGWGREASE WASTE LINEWATER METERMCONTINUATIONBFGBELOW FINISHED GRADEBFFBELOW FINISHED FLOORECOEXTERIOR CLEAN-OUTGASGAS LINE1. GAS PIPING SHALL BE INSTALLED IN ACCORDANCE WITH THE LATEST ISSUE OF THEINTERNATIONAL CODE COUNCIL OR STATE FUEL GAS CODE AND NFPA STANDARD NO.54 OR NFPA-58 WHICH APPLY.2. GAS PIPING SHALL BE TESTED IN ACCORDANCE WITH THE PROCEDURESDESCRIBED IN NFPA NO. 54. ANY OTHER TEST AS REQUIRED BY THE LOCAL GASINSPECTION DEPARTMENT OR GAS COMPANY SHALL ALSO BE PREFORMED.3. MINIMUM GAS PIPING SIZING SHALL BE 3/4".4. GAS PIPING COLOR/LABELS: EXTERIOR: LABEL ALL GAS PIPING "GAS/PRESSURE" ON PIPE AT 5'-0" CENTERS ANDCOLOR; ON ROOF PAINT WITH TWO COATS OF YELLOW ENAMEL, ON VERTICAL WALLSPAINT TO MATCH WALL COLOR. INTERIOR: LABEL ALL GAS PIPING "GAS/PRESSURE", SPACING AND COLOR PERANSI/ASME A113.1 CODE REQUIREMENTS.5. GAS PIPING SUPPORTS: EXTERIOR: PIPING ROUTED ON ROOF SHALL BE STRAPPED TO MANUFACTUREDSUPPORTS "QUICK-BLOCK" OR EQUAL. GAS SUPPORTS SPACED PER NFPA 54 7.2.5.2. INTERIOR: PIPING TO BE SUPPORTED BY CLEVIS HANGERS WITH THREADED RODOR UNI-STRUT SYSTEM. GAS SUPPORTS SPACED PER NFPA 54 7.2.5.2.6. GAS VALVES SHALL BE ANSI/CSA APPROVED, 125 PSI RATED, 2 PIECE, FULL PORT,BALL VALVES WITH BRASS BODY AND BALL. PROVIDE WITH LEVER HANDLE.7. PROVIDE UNIONS, FLANGES, OR COUPLINGS AT CONNECTION TO ALL VALVES ANDEQUIPMENT. DO NOT USE DIRECT WELDED OR THREADED CONNECTIONS TO VALVES,EQUIPMENT OR OTHER APPARATUS.CLCENTER LINEDNDOWNEXEXISTINGGCGENERAL CONTRACTORHIHAIR INTERCEPTORNICNOT IN CONTRACTOWOIL WASTE SANITARY LINEOWSOIL WASTE SEPARATORTWTEMPERED WATER LINEVBVACUUM BREAKERPROJECT DEMOLITION NOTES1. REMOVE EXISTING PLUMBING FIXTURES, EQUIPMENT, AND EQUIPMENT PADS TOTHE EXTENT INDICATED ON THE PLUMBING AND ARCHITECTURAL DEMOLITIONDRAWINGS.2. REMOVE EXISTING WATER PIPING TO THE EXTENT INDICATED ON THE DRAWINGS.POINTS OF DISCONNECTION/RECONNECTION ON DRAWINGS ARE BASED BESTAVAILABLE INFORMATION AND SHALL BE FIELD LOCATED AND ADJUSTEDACCORDINGLY. UNLESS OTHERWISE INDICATED, INACCESSIBLE EXISTINGUNDER-SLAB PIPING NOT INTERFERING WITH NEW CONSTRUCTION MAY BEABANDONED IN PLACE AFTER COMPLETELY DISCONNECTING FROM NEW SYSTEM,DRAINING, CUTTING AND CAPPING BELOW GRADE.3. REMOVE EXISTING SANITARY, WASTE, & VENT PIPING SYSTEMS TO THE EXTENTINDICATED ON THE DRAWINGS. POINTS OF DISCONNECTION/RECONNECTION ONPLANS ARE BASED BEST AVAILABLE INFORMATION AND SHALL BE FIELD LOCATEDAND ADJUSTED ACCORDINGLY. INACCESSIBLE EXISTING UNDER-SLAB PIPING NOTINTERFERING WITH NEW CONSTRUCTION MAY BE ABANDONED IN PLACE AFTERCOMPLETELY DISCONNECTING FROM NEW SYSTEM, DRAINING, CUTTING ANDCAPPING BELOW GRADE. EXISTING VTR'S OF REQUIRED SIZE AND ACCEPTABLECONDITION MAY BE RE-USED.4. EXISTING PIPING TO BE RE-USED IS SHOWN FADED.5. RECOVER ALL REFRIGERANT IN ACCORDANCE WITH ALL FEDERAL, STATE ANDLOCAL REQUIREMENTS.6. PROPERLY DISPOSE OF ALL REMOVED MATERIAL OFFSITE.7. ALL EQUIPMENT BEING REUSED SHALL BE INSPECTED FOR PROPER OPERATIONAND REASONABLE CONDITION AND SHALL BE PRESSURE TESTED WITH THE NEWSYSTEM. ALL PIPING BEING REUSED SHALL BE VISUALLY INSPECTED FORREASONABLE CONDITION, SLOPE AND INVERT, AS APPLICABLE; AND SHALL BEFLUSHED AND PRESSURE TESTED.8. EXISTING PLUMBING SYSTEM, WHERE INDICATED, ARE BASED ON BEST AVAILABLEINFORMATION. CONTRACTOR SHALL VISIT SITE PRIOR TO BIDDING AND FIELDCONFIRM EXTENT OF DEMOLITION, EXISTING INVERTS, ETC. CONTRACTOR SHALLCONFIRM ALL EXISTING CONDITIONS AS DEMOLITION OCCURS. REFER TO ORIGINALCONSTRUCTION DRAWINGS WHERE AVAILABLE FOR ADDITIONAL INFORMATION OFEXISTING CONDITIONS.FWFILTERED WATER LINE18. WATER HEATERS SUPPLYING KITCHENS SHALL BE N.S.F. APPROVED.19. ELECTRONIC IGNITION CONTROLS (120V/1/60); COORDINATE WITHELECTRICAL CONTRACTOR.20. INSTALL WATER HEATER PER MANUFACTURER'S REQUIREMENTS.COORDINATE ALL CONNECTION POINTS IN THE FIELD.21. EACH ABOVE-GROUND PORTION OF A GAS PIPING SYSTEM OTHER THANCORRUGATED STAINLESS STEEL TUBING (CSST) THAT IS LIKELY TO BECOMEENERGIZED SHALL BE ELECTRICALLY CONTINUOUS AND BONDED TO ANEFFECTIVE GROUND-FAULT CURRENT PATH. GAS PIPING OTHER THAN CSSTSHALL BE CONSIDERED TO BE BONDED WHERE IT IS CONNECTED TOAPPLIANCES THAT ARE CONNECTED TO EQUIPMENT GROUNDINGCONDUCTOR OF THE CIRCUIT SUPPLYING THAT APPLIANCE. CSST GASPIPING SYSTEMS SHALL BE BONDED TO THE ELECTRICAL SERVICEGROUNDING ELECTRODE SYSTEM AT THE POINT WHERE THE GAS SERVICEENTERS THE BUILDING. THE BONDING JUMPER SHALL NOT BE SMALLERTHAN 6 AWG COPPER WIRE OR EQUIVALENT.22, THE INSTALLING SUBCONTRACTOR SHALL BE LICENSED BY THE STATEOF FLORIDA FOR THE INSTALLATION OF GAS PIPING.23. ALL GAS EQUIPMENT SHALL BE AGA APPROVED.24. COORDINATE ROUTING OF GAS PIPING WITH CONSTRUCTION MANAGER.ASME PRESSURE/TEMP RELIEF VALVEHOT WATER RETURNGREASE WASTEFILTERED COLD WATERWATER HEATER RELIEFBUTTERFLY VALVEPLUMBING LEGEND AND PROJECT NOTES P-1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING SCHEDULES P-2SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING SCHEDULES P-2.1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SEATINGAREA101OFFICE103E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105.PLUMBING PLANS P-3SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"02'4'8'SCALE:1/4"=1'-0"SANITARY WASTE PLAN E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.SEATINGAREA101OFFICE103ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105CHM CHMCHM CHMCHM DOMESTIC WATER PLAN P-4SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"02'4'8'SCALE:1/4"=1'-0"DOMESTIC WATER PLAN E1 UTILITYCABINET.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.SEATINGAREA101OFFICE103ORDERCOUNTER102CONDIMENTAREA104WOMEN'STOILET107MEN'STOILET108JANCLOSET109WALK-INCOOLER106KITCHENPREP AREA105PLUMBING GAS PLAN AND GAS RISER P-5SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTSSCALE: 1/4" = 1'-0"02'4'8'SCALE:1/4"=1'-0"PLUMBING GAS PLANSCALE:N.T.S.GAS RISER DIAGRAM 1'-6" MIN.TO 2'-0"4" MIN.4" MIN.3" MIN.1'-6"1'-6" MIN.TO 2'-0"P-6SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SCALE:N.T.S.WALL CLEANOUT DETAIL (WCO)SCALE:N.T.S.FLOOR SINK DETAIL (FS)PLUMBING DETAILS SCALE:N.T.S.FLOOR DRAIN DETAIL (FD)SCALE:N.T.S.GAS PIPE SLEEVE THRU WALL DETAILSCALE:N.T.S.TYPICAL PIPE SLEEVE THRU WALL DETAILSCALE:N.T.S.GAS APPLIANCE PIPE SLEEVE DETAILSCALE:N.T.S.HUB DRAIN DETAIL (HD)SCALE:N.T.S.TRENCH DETAIL P-6.1SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS PLUMBING DETAILS SCALE:N.T.S.EXTERIOR TANKLESS GAS WATER HEATER DETAIL (IGWH)SCALE:N.T.S.ANTI-SCALD DEVICE DETAIL (TMV-P)SCALE:N.T.S.TRAP PRIMER DETAIL (TPV)SCALE:N.T.S.WATER HAMMER ARRESTOR DETAILSCALE:N.T.S.GREASE INTERCEPTOR SPECIFICATION .P-6SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:MJSCMDREVISIONDATE 08-23-22370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021 CAREN M. DOHERTY, P.E. FL. P.E. #-55021TENANT BUILD-OUT 363 ATLANTIC BLVD. - UNITS 6 & 7 ATLANTIC BEACH, FLORIDA 32233 ISLAND DONUTS SANITARY RISERSSCALE:N.T.S.SANITARY RISER - RESTROOMSSCALE:N.T.S.SANITARY RISER - RESTAURANT 1.ALL WORK SHALL BE COORDINATED WITH ALL TRADES INVOLVED. OFFSETS IN DUCTS, & TRANSITIONS AROUND OBSTRUCTIONS SHALL BE PROVIDED AT NO ADDITIONAL COST. MAINTAIN MANUFACTURER'S RECOMMENDED CLEARANCES. LOCATION OF DUCTWORK IS APPROXIMATE. PRIOR TO FABRICATING DUCTWORK, CONTRACTOR SHALL VERIFY ALL DIMENSIONS & CLEARANCES AND REPORT ANY DISCREPANCIES BETWEEN DRAWINGS & ACTUAL FIELD CONDITIONS TO THE ENGINEER. PRIOR TO INSTALLING EQUIPMENT, CONTRACTOR SHALL ENSURE EQUIPMENT CLEARANCES WILL BE MAINTAINED. 2. FABRICATE & INSTALL DUCTWORK IN ACCORDANCE WITH SMACNA DUCT CONSTRUCTION STANDARDS, LATEST EDITION. 3. CONDENSATE DISPOSAL SHALL BE IN ACCORDANCE WITH 2020 FMC INCLUDING ALL LATEST REVISIONS. 4. CONDENSATE PIPING SHALL BE TRAPPED AND SIZED PER MANUFACTURER'S RECOMMENDATIONS. 5. INDOOR & OUTDOOR UNITS SHALL HAVE SINGLE POINT OF CONNECTION. 6. PROVIDE CONICAL TAKE-OFFS FOR ALL ROUND TAPS INTO RECTANGULAR DUCTWORK WITH VOLUME DAMPERS AT EACH TAKE-OFF FOR CFM ADJUSTMENT. 7. COORDINATE DIFFUSER BOXES, SUPPLY, & RETURN GRILLES & OTHER MECHANICAL DEVICES WITH LIGHT FIXTURES, SPRINKLER PIPING & PLUMBING. 8. PROVIDE LOW AMBIENT CONTROLS AS NECESSARY TO ALLOW COOLING AT TEMPERATURES DOWN TO 45°F. 9. HORSEPOWER RATINGS ON MOTORS ARE BASED ON SCHEDULED EQUIPMENT & DESIGN CONDITIONS. ACTUAL FIELD CONDITIONS OR SUBSTITUTIONS FROM SCHEDULED EQUIPMENT MAY REQUIRE DIFFERENT HORSEPOWER. IF LARGER MOTOR SIZES ARE REQUIRED OR CHANGES OCCUR IN VOLTAGES, COORDINATE ELECTRICAL SERVICE TO ENSURE PROPER WIRE SIZES & DEVICES AT NO ADDITIONAL COMPENSATION (DUE TO THESE CHANGES) ASKED FOR OR REQUESTED BY ANOTHER CONTRACTOR OR TRADE. 10. REFRIGERANT LINES FROM CU's TO AHU's SHALL BE SIZED PER MANUFACTURER'S RECOMMENDATIONS. 11. ALL FAN MOTORS SHALL HAVE THERMAL OVERLOAD & CURRENT PROTECTION. 12. PROVIDE SMOKE DETECTORS IN SUPPLY DUCT FOR ALL AHU's THAT DELIVER GREATER THAN 2000 CFM OF SUPPLY AIR FOR UNIT SHUTDOWN. CONTRACTOR SHALL PROVIDE AUDIBLE & VISUAL ALARM IN A CONSTANTLY OCCUPIED LOCATION. ALARM SHALL BE LABELED "DUCT TROUBLE". 13. PROVIDE AHU's WITH PROGRAMMABLE THERMOSTATS. 14. PROVIDE UNITS WITH 1" DISPOSABLE FILTER & FILTER HOUSING, TIME DELAY RELAY & LOCKOUT RELAY. 15. PROVIDE UNITS WITH A 5 YEAR WARRANTY FOR COMPRESSORS & ONE YEAR ON OTHER PARTS. 16. ALL DUCTWORK SHALL BE CONSTRUCTED WITH FIBERBOARD OR SHEET METAL PER LATEST SMACNA STANDARDS, & SHALL HAVE A MINIMUM R VALUE OF 6. 17. MECHANICAL CONTRACTOR TO PROVIDE TENANT WITH AIR BALANCE REPORT, EQUIPMENT AND LABOR WARRANTIES AND PROVIDE A COMPLETE, OPERATIONAL MECHANICAL SYSTEM IN COMPLIANCE WITH ALL APPLICABLE CODES. 18. OUTSIDE AIR DUCTS SHALL INCLUDE INSTALLATION OF A MOTORIZED, 2-POSITION DAMPER TO ALLOW THE SCHEDULED AMOUNT OF OUTSIDE AIR TO FLOW THROUGH THE UNIT, AND CLOSE UPON UNIT SHUTDOWN. 19. ALL WORK SHALL BE PERFORMED IN ACCORDANCE WITH THE 2020 FLORIDA MECHANICAL CODE (INCLUDING ALL LATEST REVISIONS), NFPA 90A, ASHRAE 62.1-2016, AND ASHRAE 90.1. 20. PROVIDE ENGINEER OF RECORD WITH HVAC EQUIPMENT CUT SHEETS. CUT SHEETS SHALL BE APPROVED PRIOR TO INSTALLATION. 21. THE MECHANICAL CONTRACTOR SHALL VISIT THE SITE PRIOR TO SUBMITTING A BID FOR THE PROJECT. THE MECHANICAL CONTRACTOR SHALL COORDINATE DUCTWORK LOCATIONS DESIGNED BY THE MECHANICAL ENGINEER AND FIELD VERIFY ANY OBSTACLES OR CONFLICTS AND NOTE THEM IMMEDIATELY TO THE ENGINEER. NO DUCTWORK SHALL BE FABRICATED PRIOR TO FIELD VERIFYING ALL EXISTING CONDITIONS. NOTE: SOME SYMBOLS SHOWN DO NOT PERTAIN TO THIS PROJECT THERMOSTAT/SENSOR SUPPLY AIRFLOW RETURN/ EXHAUST AIRFLOW DEHUMIDISTAT AIR DEVICE TYPE CFM AMOUNT SMOKE DETECTOR DUCT TEMPERATURE SENSOR CEILING RETURN AIR GRILLE CEILING EXHAUST AIR GRILLE MANUAL VOLUME DAMPER FLEX DUCT (INSIDE DIMENSION) NEW ROUND DUCT (INSIDE DIMENSION) EXISTING DUCT TO REMAIN EXISTING DUCT TO BE REMOVED CONNECT NEW DUCT TO EXISTING DUCT TRUNCATE DUCT - LIMIT OF DEMOLITION VANED ELBOW RADIUS ELBOW TRANSITION - CONCENTRIC TRANSITION - ECCENTRIC SQUARE TEE SUPPLY DUCT (UP & DOWN) RETURN DUCT (UP & DOWN) EXHAUST DUCT (UP & DOWN) ROUND DUCT (UP & DOWN) STANDARD BRANCH TAKE-OFF DUCT / WALL MOUNTED SUPPLY REGISTER / GRILLE DUCT / WALL MOUNTED RETURN/ EXHAUST REGISTER / GRILLE MECHANICAL GENERAL NOTES SYMBOL LEGEND ABBREVIATIONS CEILING SUPPLY AIR DIFFUSERNEW RECTANGULAR DUCT (INSIDE DIMENSIONS; WIDTH X DEPTH) ABV ABOVE AFF ABOVE FINISH FLOOR AHU AIR HANDLING UNIT BDD BACKDRAFT DAMPER BHP BRAKE HORSEPOWER BTU BRITISH THERMAL UNIT CFM CUBIC FEET PER MINUTE CIRC CIRCULAR CU CONDENSING UNIT DCI DUCTLESS CEILING-CASSETTE INDOOR DCO DUCTLESS CEILING-CASSETTE OUTDOOR DN DOWN DWI DUCTLESS WALL-MOUNTED INDOOR DWO DUCTLESS WALL-MOUNTED OUTDOOR EAT ENTERING AIR TEMPERATURE EDB ENTERING DRY-BULB (TEMPERATURE) EER ENERGY EFFICIENCY RATIO EF EXHAUST FAN ESP EXTERNAL STATIC PRESSURE EWB ENTERING WET-BULB (TEMPERATURE) EX EXISTING FD FIRE DAMPER FF FLY FAN (AIR CURTAIN) FLA FULL LOAD AMPS FPM FEET PER MINUTE FT FEET GPM GALLON PER MINUTE HE HEATER HP HEAT PUMP HP HORSEPOWER HUM HUMIDIFIER IN INCHES IRH INFRARED HEATERS KEF KITCHEN EXHAUST FAN KW KILOWATT L LOUVER LAT LEAVING AIR TEMPERATURE MBH THOUSANDS BTUs PER HOUR MCA MINIMUM CIRCUIT AMPS MOCP MAXIMUM OVER CURRENT PROTECTION MOD MOTOR OPERATED CONTROL DAMPER MUA MAKE-UP AIR UNIT NA NOT APPLICABLE NC NOISE CRITERIA NC NORMALLY CLOSED NO NORMALLY OPEN NTS NOT TO SCALE OA OUTSIDE AIR OD OUTSIDE DIAMETER PSI POUNDS PER SQUARE INCH RA RETURN AIR RECT RECTANGULAR RH RELATIVE HUMIDITY RLA RUN LOAD AMPERE RTU ROOFTOP AIR HANDLING UNIT RPM REVOLUTION PER MINUTE SA SUPPLY AIR SEER SEASONAL ENERGY EFFICIENCY RATIO SF SUPPLY FAN SS STAINLESS STEEL SP STATIC PRESSURE TYP TYPICAL UC UNDERCUT DOOR UNO UNLESS NOTED OTHERWISE UTR UP THROUGH ROOF V/PH VOLTS/PHASE VCD VOLUME CONTROL DAMPER VAV VARIABLE AIR VOLUME VD VOLUME DAMPER (MANUAL OPPOSED BLADE) VFD VARIABLE FREQUENCY DRIVE W WATTS WEF WALL EXHAUST FAN HEATER SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL NOTES, LEGEND AND ABBREVIATIONSM-1 LOUVER SCHEDULE MARK DESCRIPTION TOTAL AIR (CFM)MOUNTING FACE SIZE MATERIAL BASIS OF DESIGN NOTES L-1 OUTDOOR AIR INTAKE 425 WALL MOUNTED 20" x 14"ALUMINUM GREENHECK EVH-501D 1,2 L-2 OUTDOOR AIR INTAKE 425 WALL MOUNTED 20" x 14"ALUMINUM GREENHECK EVH-501D 1,2 NOTES: 1. MATCH LOUVER COLOR AND FINISH TO EXTERIOR OF BUILDING. 2. PROVIDE BIRD SCREEN AND MOTORIZED, 2-POSITION O/A DAMPER. BRANCH & FLEX DUCT SCHEDULE 0 - 160 CFM -6"Ø 165 - 250 CFM -8"Ø 255 - 380 CFM -10"Ø 385 - 470 CFM -12"Ø 475 - 700 CFM -14"Ø 705 - 1100 CFM -16"Ø NOTE : BRANCH RUNOUT SIZE REFLECTS SUPPLY DIFFUSER NECK SIZE UNLESS OTHERWISE NOTED. SPLIT SYSTEM COOLING UNIT SCHEDULE MARK INDOOR FAN DATA COOLING CAPACITY SEER INDOOR FAN OUTDOOR FAN ELECTRICAL DATA BASIS OF DESIGNTOTAL FLOW (CFM) 0/A (CFM) ESP (W.G.) MOTOR (HP) EDB (°F) EWB (°F) AMBIENT (°F) TOTAL (BTU/HR) SENSIBLE (BTU/HR) MCA (A) MOCP (A) HEATER (kW) MCA (A) MOCP (A)VOLTS Hz PHASE AHU-1 /CU-1 1850 425 0.5 -- 80 67 95 56,200 40,600 14.5 36.4 40 8.8 21.2 35 208 60 3 YORK AVC60DX21 / TCD60B31S AHU-2 /CU-2 1850 425 0.5 -- 80 67 95 56,200 40,600 14.5 36.4 40 8.8 21.2 35 208 60 3 YORK AVC60DX21 / TCD60B31S NOTES: 1. UNITS PROVIDED SHALL MEET ALL SCHEDULED VALUES REGARDLESS OF MODEL OR TYPE, UNLESS APPROVED BY THE ENGINEER. 2. PROVIDE EACH UNIT WITH A PROGRAMMABLE THERMOSTAT MOUNTED @ 48" AFF. 3. PROVIDE WATER-LEVEL DETECTION DEVICE INSIDE PRIMARY DRAIN PAN THAT WILL SHUT OFF UNIT WHEN THE PRIMARY DRAIN PAN BECOMES RESTRICTED. 4. PROVIDE MOTORIZED O/A DAMPER SET WITH TIMECLOCK TO CLOSE DURING UNOCCUPIED TIMES 5. CONDENSING UNITS ON ROOF WITH LANDLORD APPROVED CONDENSING STANDS. EXHAUST FAN / MAKE-UP AIR SCHEDULE MARK SERVICE TOTAL AIR (CFM) E.S.P. (W.G)UNIT TYPE DRIVE POWER (W)FLA VOLTS/PH/HZ MANUFACTURER MODEL NUMBER NOTES EF-1,2 TOILET ROOM 70 0.13 CEILING DIRECT 15 0.27 115/1/60 GREENHECK SP-A70 1,2 KEF-1 KITCHEN 3035 1.5 ROOF DIRECT --7.5 230/3/60 CAPTIVE AIRE EADU180H 3,4,5 MUA-1 KITCHEN 2428 0.5 ROOF DIRECT --3.4 230/3/60 CAPTIVE AIRE EA-A2-20D 3,4 NOTES: 1. INTERLOCK WITH LIGHT SWITCH. 2. PROVIDE BACKDRAFT DAMPER. 3. INTERLOCK WITH HOOD. 4. PROVIDE DISCONNECT. 5. PROVIDE VENTED HINGE CURB. AIR DISTRIBUTION DEVICE SCHEDULE MARK DESCRIPTION MOUNTING FACE SIZE BASIS OF DESIGN NOTES A 4-WAY SUPPLY LAY-IN 24"x 24" / 12"x 12" / 12"x 6"TITUS TMS 1,2 B EGGCRATE RETURN LAY-IN 24"x 24" / 12"x 12"TITUS 50F 2 C 2-WAY SUPPLY DUCT 12" x 6"TITUS 300FS 1,2 D RETURN REGISTER DUCT 22" x 22"TITUS 355FS 1,2 E PERFORATED DIFFUSER LAY-IN 24"x 24"TITUS PCS 1,2 NOTES: 1. LOUVER FACE. 2. WITH OPTIONAL DAMPER. MUA CONDENSING UNITS MARK COOLING CAPACITY ELECTRICAL DATA BASIS OF DESIGN NOTES TOTAL TONS SEER MOCP MCA VOLTS HZ PHASE CU-3 5 14 30 21.5 208/230 60 3 A2-20D-MPU -SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL SCHEDULESM-2 E1UTILITYCABINET.EF-2 EF-1 A 225 A 225 A 50 A 50 A 50 A 100 AHU-1AHU-2E 350 E 350 E 350 A 100 A 275 B 700 B 725 E 275 WALLCAP L-2 425 L-1 425 B 650 B 675 A 250 A 275 A 275 A 250 A 250 B 100 KEF-118"x16"8"x10"12"x12"10"x10"16"x14"12"x10" 6"x8" 18"x16"20"x18"6"Ø8"Ø6"x8"8"x8" CU-2 CU-1 MUA-16"x8"18"x18"MUA 809 MUA 809 MUA 810 12"x10"12"x10"MM20"x18"20"x16" 16"x16" 18"x16" 14"x14" ON ROOF ON ROOF WALK-IN-COOLER 106 JAN CLOSET 109 MEN'S ROOM 108 WOMEN'S ROOM 107 KITCHEN/ PREP/DW 105 ORDER COUNTER 102 SEATING AREA 101 OFFICE 103 CONDIMENT AREA 104 CU-3SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL PLANSCALE:3/8"=1'-0" MECHANICAL PLAN M-3 SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL DETAILSM-4 SCALE: N.T.S. DUCT HANGER DETAIL SCALE: N.T.S. RADIUS ELBOW - RECT. DUCT SCALE: N.T.S. ELBOW DETAIL - RECT. DUCT SCALE: N.T.S. FLEX DUCT CONNECTION DETAIL SCALE: N.T.S. TOILET EXHAUST DETAIL SCALE: N.T.S. DUCT OFFSET SCALE: N.T.S. TYPICAL BRANCH TAKE-OFF DETAIL SCALE: N.T.S. AHU CONNECTION DETAIL Jacksonville Office REGION 65 PHONE: (904) 463-6242 EMAIL: reg65@captiveaire.com FOR QUESTIONS, CALL THE 1 5424 ND-2-PSP-F CAPTIVEAIRE 12' 11"600 DEG I HEAVY 235 3035 4"18"3035 1717 -1.298"2428 430 SS WHERE EXPOSED ALONE ALONE HOOD NO TAG MODEL MANUFACTURER LENGTH MAX COOKING TEMP TYPE APPLIANCE DUTY DESIGN CFM/FT TOTAL EXH CFM EXHAUST PLENUM RISER(S) WIDTH LENG HEIGHT DIA CFM VEL SP TOTAL SUPPLY CFM HOOD CONSTRUCTION HOOD CONFIG END TO END ROW 1 CAPTRATE SOLO FILTER 9 16"16"85% SEE FILTER SPEC 4 RECESSED ROUND NO LEFT 12"x54"x24"TANK FS 4.0/4.0 DCV-1111 1 LIGHT 1 FAN YES 1050 LBS HOOD NO TAG FILTER(S) TYPE QTY HEIGHT LENGTH EFFICIENCY @ 7 MICRONS LIGHT(S) QTY TYPE WIRE GUARD UTILITY CABINET(S) LOCATION SIZE FIRE SYSTEM TYPE SIZE ELECTRICAL MODEL # SWITCHES QUANTITY FIRE SYSTEM PIPING HOOD HANGING WEIGHT 1 FIELD WRAPPER 18.00" HIGH FRONT, LEFT, RIGHT. BACKSPLASH 80.00" HIGH X 168.00" LONG 430 SS VERTICAL. RIGHT SIDESPLASH 80.00" HIGH X 54.00" LONG 430 SS VERTICAL. RIGHT END STANDOFF (FINISHED) 1" WIDE 54" LONG INSULATED. LEFT QUARTER END PANEL 23" TOP WIDTH, 0" BOTTOM WIDTH, 23" HIGH 430 SS. RIGHT WALL AS END PANEL. HOOD NO TAG OPTION 1 Front 168"16"6" MUA MUA MUA 12" 12" 12" 28" 28" 28" 809 809 809 0.210" 0.210" 0.210" HOOD NO TAG POS LENGTH WIDTH HEIGHT TYPE RISER(S) WIDTH LENG DIA CFM SP PATENT NUMBERS AC-PSP WALL (CANADA) - CA PATENT 2820509. AC-PSP (UNITED STATES) - US PATENT 7963830 B2. AC-PSP ISLAND (CANADA) - CA PATENT 2520330. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 322331500500 FLOW RATE (CFM) 1000 0.00 0 0.50PRESSURE DROP (in. H20)PRESSURE DROP VS. FLOW RATE RRSPECIFICATION: CAPTRATE GREASE-STOP SOLO FILTER A UNIQUE S-BAFFLE DESIGN IN CONJUNCTION WITH A SLOTTED REAR BAFFLE DESIGN, THE CAPTRATE GREASE-STOP SOLO FILTER IS A SINGLE-STAGE FILTER FEATURING LARGER, WITH A CORRESPONDING PRESSURE DROP NOT TO EXCEED 1.0 INCHES OF WATER GAUGE. FILTER IS STAINLESS STEEL CONSTRUCTION, AND SIZED TO FIT INTO STANDARD GREASE EXTRACTION EFFICIENCY PERFORMANCE SHALL REMOVE AT LEAST 75% OF GREASE PARTICLES FIVE MICRONS IN SIZE, AND 85% GREASE PARTICLES SEVEN MICRONS IN SIZE AND COMPONENTS WHEN ASSEMBLED. 2-INCH DEEP HOOD CHANNEL(S). TO DELIVER EXCEPTIONAL FILTRATION EFFICIENCY. UNITS SHALL INCLUDE STAINLESS STEEL HANDLES AND A FASTENING DEVICE TO SECURE THE TWO FRACTIONAL EFFICIENCY (%)0 0.1 20 40 1.0 PARTICLE DIAMETER (UM) 10.0 EFFICIENCY VS. PARTICLE DIAMETER 60 80 100 THE CAPTRATE GREASE-STOP SOLO WAS TESTED TO ASTM STANDARD ASTM F2519-05.TE ANSF ACCORDANCE No. 96 NFPA WITH BUILT IN SLI DTE RO C H B N RAN I,OR M .YRO RLAIGNTSB ATCAPTRATE FILTERS ARE BUILT IN COMPLIANCE WITH:. NFPA #96. NSF STANDARD #2. UL STANDARD #1046. INT. MECH. CODE (IMC). ULC-S649. 1.00 1.50 2.00 2.50 3.00 3.50 MANUFACTURER APPROVED FOR USE IN SOLID FUEL APPLICATIONS AS A SPARK ARRESTER. GREASE DUCT & CHIMNEY SPECIFICATIONS: PROVIDE GREASE DUCT EQUAL TO ECON-AIR MODEL "EDW" ROUND 20 GAUGE 430 STAINLESS STEEL DUCTWORK. MODEL "EDW" IS LISTED TO UL-1978 AND IS INSTALLED USING "V" CLAMP LOCKING CONNECTIONS SEALED WITH 3M FIRE BARRIER 2000 PLUS. MODEL "EDW" DOES NOT REQUIRE WELDING PROVIDING IT HAS BEEN INSTALLED PER THE MANUFACTURES INSTALLATION GUIDE. PROVIDE RATED ACCESS DOORS AT EVERY CHANGE IN DIRECTION AND EVERY 12' ON CENTER. PER MANUFACTURES LISTING MODEL "EDW" HORIZONTAL RUNS LESS THAN 75 FT. CAN BE SLOPED 1/16" PER 12", HORIZONTAL RUNS MORE THAN 75 FT. CAN BE SLOPED 3/16" PER 12". DUCT SHOULD BE SLOPED AS MUCH AS POSSIBLE TO REDUCE THE CHANCE OF GREASE ACCUMULATION IN HORIZONTAL RUNS. IF THE DUCT OR CHIMNEY IS WITHIN 18 INCHES OF COMBUSTIBLE MATERIAL, PROVIDE UL-2221 OR UL-103 HT LISTED DOUBLE WALL GREASE DUCT OR DOUBLE WALL CHIMNEY EQUAL TO ECON-AIR MODEL "EDW- 2R, 2R TYPE HT, 3R, OR 3Z" ROUND 20 GAUGE 430 STAINLESS INNER DUCT INSULATED WITH A 24 GAUGE 430 STAINLESS OUTER SHELL. § ECON-AIR RECOMMENDS THE USE OF LISTED, PRE-FABRICATED ROUND GREASE EXHAUST DUCT TO REDUCE STATIC PRESSURE IN THE SYSTEM, MINIMIZE INSTALLATION AND INSPECTION TIMES, AND ENSURE DUCT IS LIQUID TIGHT CUSTOMER APPROVAL TO MANUFACTURE: ___' - ___" VERIFY CEILING HEIGHT HVAC DISTRIBUTION NOTE HIGH VELOCITY DIFFUSERS OR HVAC RETURNS SHOULD NOT BE PLACED WITHIN TEN (10) FEET OF THE EXHAUST HOOD. PERFORATED DIFFUSERS ARE RECOMMENDED. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL ALL-THREAD. HOOD CORNER HANGING ANGLE (WEIGHT BEARING ANCHOR POINT FOR HOOD). HOOD CORNER HANGING ANGLE 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. ASSEMBLY INSTRUCTIONS HANGING ANGLE MUST BE SUPPORTED WITH 1/2" - 13 TPI GRADE 5 (MINIMUM) ALL-THREAD. SANDWICH HANGING ANGLES AND CEILING ANCHOR POINTS WITH 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHERS AND 1/2" - 13 TPI GRADE 5 (MINIMUM) HEX NUTS AS SHOWN. MUST USE DOUBLED HEX NUT CONFIGURATION BENEATH HOOD HANGING ANGLES AND ABOVE CEILING ANCHORS. MAINTAIN 1/4" OF EXPOSED THREADS BENEATH BOTTOM HEX NUT. TORQUE ALL HEX NUTS TO 57 FT-LBS. (HARDWARE BY INSTALLER) 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. SUPPLY PLENUM HANGING ANGLE (WEIGHT BEARING ANCHOR POINT FOR SUPPLY PLENUM). SUPPLY PLENUM HANGING ANGLE 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL ALL-THREAD. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. ASSEMBLY INSTRUCTIONS HANGING ANGLE MUST BE SUPPORTED WITH 1/2" - 13 TPI GRADE 5 (MINIMUM) ALL-THREAD. SANDWICH HANGING ANGLES AND CEILING ANCHOR POINTS WITH 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHERS AND 1/2" - 13 TPI GRADE 5 (MINIMUM) HEX NUTS AS SHOWN. MUST USE DOUBLED HEX NUT CONFIGURATION ABOVE CEILING ANCHORS. SINGLE HEX NUT BENEATH HANGING ANGLE IS ACCEPTABLE FOR PSP HANGING ANGLES. MAINTAIN 1/4" OF EXPOSED THREADS BENEATH BOTTOM HEX NUT. TORQUE ALL HEX NUTS TO 57 FT-LBS. (HARDWARE BY INSTALLER) SYSTEM DESIGN VERIFICATION (SDV) IF ORDERED, CAS SERVICE WILL PERFORM A SYSTEM DESIGN VERIFICATION (SDV) ONCE ALL EQUIPMENT HAS HAD A COMPLETE START UP PER THE OPERATION AND INSTALLATION MANUAL. TYPICALLY, THE SDV WILL BE PERFORMED AFTER ALL INSPECTIONS ARE COMPLETE. ANY FIELD RELATED DISCREPANCIES THAT ARE DISCOVERED DURING THE SDV WILL BE BROUGHT TO THE ATTENTION OF THE GENERAL CONTRACTOR AND CORRESPONDING TRADES ON SITE. THESE ISSUES WILL BE DOCUMENTED AND FORWARDED TO THE APPROPRIATE SALES OFFICE. IF CAS SERVICE HAS TO RESOLVE A DISCREPANCY THAT IS A FIELD ISSUE, THE GENERAL CONTRACTOR WILL BE NOTIFIED AND BILLED FOR THE WORK. SHOULD A RETURN TRIP BE REQUIRED DUE TO ANY FIELD RELATED DISCREPANCY THAT CANNOT BE RESOLVED DURING THE SDV, THERE WILL BE ADDITIONAL TRIP CHARGES. DURING THE SDV, CAS SERVICE WILL ADDRESS ANY DISCREPANCY THAT IS THE FAULT OF THE MANUFACTURER. SHOULD A RETURN TRIP BE REQUIRED, THE GENERAL CONTRACTOR AND APPROPRIATE SALES OFFICE WILL BE NOTIFIED. THERE WILL BE NO ADDITIONAL CHARGES FOR MANUFACTURER DISCREPANCIES. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-4 12' 11"NOM./12' 11.00"OD. 14'-0.00" OVERALL LENGTH 54" 12" UTILITY CABINET. 16" 28" 8" 12" 28" 56" 8" 12" 28" 56" 8" 12" 28" 1" LAYER OF INSULATION FACTORY INSTALLED IN 1.00" END STANDOFF MEETS 0" REQUIREMENTS CLEARANCE TO COMBUSTIBLE SURFACES. 1" 3" § 77 1/2"77 1/2" 12" Ø18" U.L. LISTED RECESSED ROUND LED FIXTURE AND LED LIGHT. INSTALLER MUST CONFIRM HOOD IS INSTALLED SUCH THAT THE SPECIFIED WALL, ACTING AS AN END PANEL, IS MATED TIGHT TO THE CORRECT END OF HOOD TO ACHIEVE A REDUCED MINIMUM EXHAUST CFM LISTING. NON-COMPLIANCE WILL NULLIFY THE ETL LISTING, VOID THE MANUFACTURER'S WARRANTY, AND HOLD THE CONTRACTOR LIABLE FOR ANY AND ALL LOSSES, COSTS, AND EXPENSES RELATED TO THE NON-CONFORMANCE OF THE MANUFACTURER'S SPECIFIED INSTRUCTION. THE WALL ACTING AS AN END PANEL MUST EXTEND NO LESS THAN 20" FROM THE INTERSECTING WALL ON WHICH HOOD IS MOUNTED AND MUST EXTEND NO LESS THAN 20" UNDER BOTTOM OF HOOD TO BE ELIGIBLE FOR REDUCED MINIMUM EXHAUST CFM LISTING. NOTE: ADDITIONAL HANGING ANGLES PROVIDED FOR HOODS 12' AND LONGER. 3" INTERNAL STANDOFF. GREASE DRAIN WITH REMOVABLE CUP. SEE HOOD TABLE. §EXHAUST RISER. HANGING ANGLE. RECESSED ROUND LED FIXTURE AND LED LIGHT, 3500 K WARM OUTPUT. 23.5% OPEN STAINLESS STEEL PERFORATED PANEL. ATTACHING PLATES. SUPPLY RISER WITH VOLUME DAMPER. 6" 2 3/4" 16" 18" BACKSPLASH 80.00" HIGH X 168.00" LONG. FIELD WRAPPER 18.00" HIGH (SEE HOOD OPTIONS TABLE). RIGHT WALL AS END PANEL. 23" 23" LEFT QUARTER END PANEL. EQUIPMENT BY OTHERS. 48.0" MAX. 80" 24" NOM. 54" IT IS THE RESPONSIBILITY OF THE ARCHITECT/OWNER TO ENSURE THAT THE HOOD CLEARANCE FROM LIMITED-COMBUSTIBLE AND COMBUSTIBLE MATERIALS IS IN COMPLIANCE WITH LOCAL CODE REQUIREMENTS. 16" CAPTRATE SOLO FILTER WITH HOOK. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-5 SECTION 23 38 13 13 SPECIFICATIONS TAG: Commercial Kitchen Ventilation Hoods, Listed Commercial Kitchen Hoods PART 1 - GENERAL 1.1 SUMMARY A. The ND2 series is a Type I, wall canopy hood for use over 600°F cooking surface temperatures. The aerodynamic design includes a mechanical baffle and performance enhancing lip for exceptional capture and containment. B. The hood shall have the size, shape, and performance specified on drawings. 1.2 SUBMITTALS A. The manufacturer assumes no liability for the use or results of use from this document. Specifications are to be reviewed by the engineer to confirm the project’s requirements and meet Federal, State, and Local codes and regulations. B. As the manufacturer continues product development, it reserves the right to change design and specifications without notice. C. The manufacturer shall supply complete computer generated submittal drawings, including hood section view(s) and hood plan view(s). These drawings must be available to the engineer, architect, and owner for their use in construction, operation, and maintenance. 1.3 QUALITY ASSURANCE A. This hood is ETL-listed to standard UL710, ULC710, and ULC-S646 when installed in accordance with these installation instructions and National Fire Protection Association Standard “NFPA 96, Standard for Ventilation Control and Fire Protection of Commercial Cooking Operations.” B. Built-in compliance with NSF/ANSI Standard 2. C. The hood shall be ETL Listed as: 1. “Exhaust Hood Without Exhaust Damper.” 2. ETL Sanitation Listed and built in accordance with NFPA 96. 3. The ETL label shall list temperature rating(s) and minimum CFM/ft rating(s). 1.4 WARRANTY A. All units shall be provided with the following standard warranty: 1. This equipment is warranted to be free from defects in materials and workmanship, under normal use and service, for a period of 2-years from date of shipment. B. The manufacturer shall not be liable for incidental and consequential losses and damages potentially attributable to malfunctioning equipment. Should any part of the equipment prove to be defective in material or workmanship within the 2-year warranty period, upon examination by the manufacturer, such part will be repaired or replaced by manufacturer at no charge. The buyer shall pay all labor costs incurred in connection with such repair or replacement. Equipment shall not be returned without manufacturer’s prior authorization, and all returned equipment shall be shipped by the buyer, freight prepaid to a destination determined by the manufacturer. C. Refer to Manufacturer’s Operation, Installation, and Maintenance (OIM) Manual for detailed descriptions of what is/is not covered and contact information for warranty claims. PART 2 - PRODUCTS 2.1 GENERAL A. Construction shall be dependent on the structural application to minimize distortion and other defects. All seams, joints, and penetrations of the hood enclosure to the lower outermost perimeter, which directs and captures grease-laden vapor and exhaust gases, shall have a liquid-tight continuous external weld in accordance with NFPA 96. B. Duct sizes, CFM, and static pressure requirements shall be as shown on drawings. Static pressure requirements shall be precise and accurate; air velocity and volume information shall be accurate within 1-ft increments along the length of the ventilator. 2.2 CONSTRUCTION A. Construction shall be type 430 stainless steel. B. Double wall insulated front to eliminate condensation and increase rigidity on wide sizes. The insulation shall have a flexural modulus of 475 EI, meet UL 181 requirements and be in accordance with NFPA 90A and 90B. C. Hood shall be equipped with a minimum of four connections for hanger rods. Hood lengths greater than 12’ will have added hangers. D. Exhaust duct collar to be 4” high with flange. E. The grease drain system shall be an enclosed integral part of the hood back and have slopes with an exposed, removable 1/2 grease cup to facilitate cleaning. F. An integral baffle to direct grease laden vapors toward the exhaust filter bank. G. Hood shall be furnished with UL classified filters, supplied in size and quantity as required by ventilator. H. All seams shall be welded and have stainless steel on exposed surfaces. 2.3 LIGHTING A. Recessed round LED fixture and LED light, 3500K Warm output. 2.4 FILTERS A. Stainless Steel Captrate Solo filter with hook, ETL Listed. Particulate capture efficiency: 85% efficient at 9 microns, 76% efficient at 5 microns. 2.5 OPTIONS A. Fire Suppression System: UL 300 fire suppression system. B. Optional perforated supply plenum shall provide make-up air discharged below the cooking equipment. 1. Perforated diffuser plates shall be included in the design to provide even air distribution. 2. Unexposed surfaces shall be constructed of aluminized steel. Plenum shall be insulated to prevent condensation. 3. Perforated Supply Plenum (PSP) C. Hood Mounted Utility Cabinet - Cabinet can store listed fire suppression system, listed components, pre-wired electrical controls. 2.6 ACCESSORIES A. End Panel(s) maximize hood performance and eliminate the effects of cross drafts in the kitchen. Units constructed of stainless steel and sized according to hood width and cooking equipment. Exposed edges hemmed for safety and rigidity. Selected panels: 1. Quarter End Panel 2. Wall as End Panel B. Splash panel(s) selected: 1. Backsplash 2. Right Sidesplash C. Standoff(s) selected: 1. Right End Standoff D. Wrapper(s) may be installed from the factory or field installed. Wrapper(s) selected: 1. Wrapper PART 3 - EXECUTION 3.1 EXAMINATION A. Examine areas and conditions under which the system is installed. Do not proceed with work until unsatisfactory conditions have been corrected in a manner acceptable to Installer. 3.2 INSTALLATION A. Install in accordance with manufacturer's instructions, drawings, written specifications, manufacturer’s installation manual, and all applicable building codes. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-6 1 TANK FS 4.0/4.0 37 FIRE CABINET LEFT LEFT, HOOD 1 FIRE SYSTEM NO TAG TYPE SIZE FLOW POINTS INSTALLATION SYSTEM LOCATION ON HOOD 1 SC ELECTRICAL 0.750 CAPTIVEAIRE SYSTEMS FIRE SYSTEM NO TAG TYPE SIZE SUPPLIED BY FACTORY PIPING EXTENDS A MAXIMUM OF 6" ABOVE THE TOP OF THE HOOD. 12" Ø18" HOOD FRONT HOOD BACK HOOD # 1 JOB # 5577674 FS # 1 MODEL: ND-2-PSP-F SIZE: 54"x24" LENGTH: 12' 11"TANK OVERLAPPING PROTECTION- 30HIGH PROXIMITY132.00" L X30.00" DDUCT S 360 OL-F OL-F OL-F 25.0000 21.50" OL-F 21.50" OL-F 21.50" OL-F 21.50" OL-F 21.50" OL-F NOZZLE HEIGHT 35-50" FROM COOKING SURFACE. (45.2500) 35.0000 27.0000 27.0000 27.0000 27.0000 12.0000 - SYSTEM REQUIRES A MINIMUM OF 7 FT OF EQUIVALENT PIPE LENGTH BETWEEN TANK AND NEAREST APPLIANCE NOZZLE FOR MOST APPLIANCES. EACH 90 DEGREE ELBOW ADDS 1.3 FT OF EQUIVALENT LENGTH. SEE MANUAL FOR DETAILS 7 1 631 2 5 PLENUMPLENUMNOTES - FIELD PIPE DROPS AS SHOWN PIPING, ELBOWS, TEES, AND NOZZLES SUPPLIED BY CAS. - FIELD INSTALLED DROP: FACTORY WILL PROVIDE QTY 2 60IN LONG PIECES OF CHROME PLATED PIPING SHIPPED LOOSE TO BE FIELD-INSTALLED. - SHIP LOOSE DROP: FACTORY WILL PROVIDE THE EXACT CHROME PIPE LENGTH NEEDED SHIPPED LOOSE TO BE FIELD-INSTALLED. - RELOCATE NOZZLES IF FLOW PATTERN IS BLOCKED BY SHELVING, SALAMANDERS, ETC. - OVERLAPPING COVERAGE SHALL NOT BE USED ON ANY APPLIANCE WITH AN OBSTRUCTION. - IF APPLICABLE, EXTENDED PRE-PIPED DROPS ARE SHIPPED LOOSE. - FACTORY PIPING EXTENDS A MAXIMUM OF 6" ABOVE THE TOP OF THE HOOD. - APPLIANCE DIMENSIONS LISTED REPRESENT THE COOKING SURFACE SIZE, NOT THE OVERALL APPLIANCE SIZE. - THIS FIRE SYSTEM COMPLIES WITH U.L. 300 REQUIREMENTS. - OL-F NOZZLE PART NUMBER REPLACES 3070-3/8H-10-SS JOB #: 5577674. JOB NAME: ISLAND DONUTS. SYSTEM SIZE: TANK-SP-2 TOTAL FP REQUIRED: 37. HOOD # 1 12' 11.00" LONG x 54" WIDE x 24" HIGH. RISER # 1 SIZE: 18" DIA. HOOD # 1 METAL BLOW-OFF CAPS INCLUDED. - HEAVY-DUTY APPLIANCES (RATED 600°F) WILL REQUIRE AN ADDITIONAL DOWNSTREAM FIRESTAT IN THE EVENT THAT THE DUCTWORK CONTAINS ANY HORIZONTAL RUNS OVER 25 FT IN LENGTH. - MEDIUM TO LIGHT-DUTY APPLIANCES (RATED 450°F) WILL NOT REQUIRE ANY ADDITIONAL DOWNSTREAM DETECTION. PRESSURE SUPERVISION SWITCH. PRIMARY ACTUATOR RELEASE. 4 GALLON TANK. 7 6 5 4 2 1 PRIMARY HOSE ASSEMBLY. SECONDARY ACTUATOR RELEASE.3 SECONDARY HOSE ASSEMBLY. REMOTE MANUAL ACTUATION DEVICE. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 322333/4" VALVE SHOWN FOR REFERENCE. CONFIRM WITH PLUMBER REQUIRED VALVE SIZE. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-7 SECTION 21 23 00 WET- CHEMICAL FIRE-EXTINGUISHING SYSTEMS TAG: TANK Fire Suppression PART 1 - GENERAL 1.1 SUMMARY A. TANK Fire Suppression is a pre-engineered, stored-pressure wet chemical solution extinguishing system. 1.2 SUBMITTALS A. The manufacturer assumes no liability for the use or results of use from this document. Specifications are to be reviewed by the engineer to confirm the requirements of the project and meet Federal, State, and Local codes. B. As the manufacturer continues product development, it reserves the right to change design and specifications without notice. 1.3 QUALITY ASSURANCE A. TANK Fire Suppression System shall be UL & ULC listed in accordance with UL300, UL1254, ULCORD-C1254.6. B. Microprocessor-based control board shall be ETL Listed to UL Standard 864 and CAN/ ULC-S527-11. C. TANK Fire Suppression System intended for installation and for use in accordance with the National Fire Protection Association Standards: 1. Wet Chemical Extinguishing Systems, NFPA 17A 2. National Electrical Code, NFPA 70 3. National Fire Alarm & Signaling Code, NFPA 72 D. New York City and FDNY approved under COA# 5870. E. California State Fire Marshal (CFSM), Listing No. 7085-2199:0502. 1.4 WARRANTY A. All units shall be provided with the following standard warranties: 1. TANK Fire Suppression System is warranted to be free from defects in materials and workmanship, under normal use and service, for a period of 60-months from date of shipment. B. Warranty does not cover consumable products such as batteries and nitrogen. C. The manufacturer shall not be liable for incidental and consequential losses and damages potentially attributable to malfunctioning equipment. Should any part of the equipment prove to be defective in material or workmanship within the 60-month warranty period, upon examination by the manufacturer, such part will be repaired or replaced by manufacturer at no charge. The buyer shall pay all labor costs incurred in connection with such repair or replacement. Equipment shall not be returned without manufacturer’s prior authorization, and all returned equipment shall be shipped by the buyer, freight prepaid to a destination determined by the manufacturer. D. Refer to Manufacturer’s Operation, Installation, and Maintenance (OIM) Manual for detailed descriptions of what is/is not covered and contact information for warranty claims. PART 2 - PRODUCTS 2.1 GENERAL A. A pre-engineered, fixed pipe, automatic wet chemical agent fire suppression system for protection of all hazard areas associated with cooking operations, including exhaust hoods, plenums, ductwork, and cooking appliances. 2.2 COMPONENTS A. Exhaust hood fire system components to be factory installed. B. Cylinder and Valve Assembly 1. The cylinders shall have a tin-nickel alloy plated brass valve with pressure gauge. 2. Wet chemical agent shall be contained in one or more stored pressure DOT/TC rated steel cylinder and valve assemblies. 3. Each cylinder is factory-filled with liquid fire suppressant and pressurized to 200 PSIG at 70°F. C. Distribution Nozzles 1. Nozzles shall be located to protect the exhaust ducts, plenums, and all cooking appliances requiring protection. 2. All nozzles shall be equipped with a metal blow off cap. The cap prevents contamination from entering the pipe network and is designed to pop-off upon system discharge, allowing agent to flow to the protected hazard area. 3. All nozzles shall incorporate a stamped part number to easily identify nozzle type. D. Distribution System 1. The distribution system shall consist of Copper, Schedule 40 black iron, chrome-plated or stainless-steel pipe and fittings. All exposed piping and fittings must be chrome-plated or stainless steel. 2. Fittings shall be minimum class 150. Galvanized fittings shall not be used. E. Suppression System 1. The system control equipment shall be capable of all functions associated with automatically and manually discharging the wet chemical agent from all cylinder and valve assemblies, including automatic shutdown of the heat source or fuel and electrical power to all protected areas upon system discharge. 2. Liquid Fire Suppressant shall be Aqueous Potassium Carbonate (APC). 3. All mechanical components of the actuator kit shall be enclosed. 4. The actuator kit shall be capable of automatic or manual activation means. 5. Supervisory Pressure Switch added to monitor operating system pressure. 6. For manual activation, an electrically operated manual release shall be used to actuate the system manually. 7. For automatic activation, the system will be activated by a Firestat (heat) detector. F. Electrical 1. Electrical Division to provide shunt trip breakers at main power panel, or disconnects, as designated by the Electrical Engineer; interconnection provided at hood control panel for the signal to shut down all electricity in and under the exhaust hood. Shunt trips/disconnects to accomplish shut off of electricity in the event of fire system activation by others. 2. Printed circuit board with microprocessor-based controller that provides all the necessary monitoring, timing, and supervision functions required for the reliable operation of the fire system. 3. Independent supervised loops incorporate redundancy and fault detection. 4. Real-time cloud-based monitoring connection provided with system by ownership. 5. Primary power supply, with battery backup for power loss. 6. All wiring must be in accordance to NFPA 70 and the Authority Having Jurisdiction (AHJ). 7. Electric gas valve provided for equipment below exhaust hood. Coordinate size and installation with Plumbing Division. 8. All wiring is to be in accordance with the applicable manufacturer’s instructions for the fire alarm control panel, gas shut-off valve, manual reset relay, and contractor supplied shut-off devices. PART 3 - EXECUTION 3.1 EXAMINATION A. Examine areas and conditions under which the system is installed. Do not proceed with work until unsatisfactory conditions have been corrected in manner acceptable to Installer. 3.2 APPLICATION A. Wet chemical-based fire suppression system for use in commercial kitchens. It can be mounted in the integral cabinet located at the end of the hood or offered as a wall mount package. 3.3 INSTALLATION A. As part of this item, provide wall mounted type K handheld portable fire extinguisher, placard, and mounting bracket as required in the immediate vicinity of each cooking area, per NFPA-96 and NFPA-10. Additional fire extinguishers as required in the kitchen area are to be specified by the Architect and provided by the General Contractor. B. Install in accordance with manufacturer's instructions, drawings, written specifications, manufacturer’s installation manual, and all applicable building codes. C. Six-month and twelve-month inspections, servicing, and replacement of components as per NFPA 96 to be provided by the General Contractor or Owner. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-8 1 1 DU180HFA CAPTIVEAIRE 3035 1.500 1310 ODP,PREMIUM 2.000 1.6130 3 230 7.5 701 FPM 187 19.5960561273157 FAN UNIT NO TAG QTY FAN UNIT MODEL #MANUFACTURER CFM ESP RPM MOTOR ENCL HP BHP PHASE VOLT FLA DISCHARGE VELOCITY WEIGHT (LBS)SONES 2 A2-20D-MPU 1 5 208-230 3 PHASE 60 HZ 21.5 AMPS 15.96 AMPS 30 AMPS 10 AWG 14 FAN UNIT NO TAG FAN UNIT MODEL #CONDENSER NO TONNAGE VOLTAGE PHASE FREQUENCY MCA RLA MAX FUSE SIZE MIN WIRE SIZE SEER 2 1 A2-20D-MPU 20MF-2-MOD A2 2000 2428 0.500 1026 ODP,PREMIUM 1.000 0.5950 3 230 3.4 4.3A 15A 1190 9.52611154762678 FAN UNIT NO TAG QTY FAN UNIT MODEL #BLOWER HOUSING MIN CFM DESIGN CFM ESP RPM MOTOR ENCL HP BHP PHASE VOLT FLA MCA MOCP WEIGHT (LBS)SONES 2 DX 2428 91.0°F 77.0°F 78.2°F 70.8°F ------------58.5 MBH 32.8 MBH 25.7 MBH --------------------------- FAN UNIT NO TAG COIL TYPE DESIGN CFM COOLING ENTERING DB TEMP ENTERING WB TEMP LEAVING DB TEMP LEAVING WB TEMP ENTERING FLUID TEMP LEAVING FLUID TEMP FLUID FLOW RATE PERCENT GLYCOL TOTAL CAPACITY SENSIBLE CAPACITY LATENT CAPACITY HEATING ENTERING DB TEMP LEAVING DB TEMP ENTERING FLUID TEMP LEAVING FLUID TEMP FLUID FLOW RATE PERCENT GLYCOL STEAM PRESSURE TOTAL CAPACITY SENSIBLE CAPACITY 2 A2-20D-MPU 35.0°F 12.0°F 47.0°F FAN UNIT NO TAG FAN UNIT MODEL # HEATING MODE ENTERING DB TEMP HEATING MODE TEMP RISE HEATING MODE DISCHARGE DB TEMP 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 GREASE BOX FAN BASE CERAMIC SEAL - SHIP LOOSE - FOR GREASE DUCTS MIAMI DADE CERTIFICATION - NOA-1 ALUMINUM UPBLAST 2 YEAR PARTS WARRANTY SIZE 2 UNTEMPERED COMMERCIAL DOWN DISCHARGE FOR DIRECT DRIVE AHUS MIAMI DADE CERTIFICATION - NOA-2 SUPPLY 5 TON SINGLE CIRCUIT MODULAR PACKAGED COOLING OPTION WITH HEAT PUMP FOR SIZE 2 MUA (2,000 TO 3,000 CFM), 208V/230V, 3 PHASE INSULATED BLOWER SECTION SIZE 1-2 COMMERCIAL MOD PACKAGE UNIT HEAT PUMP CONTROLS FOR UNTEMPERED FANS MIXING BOX SHELL FOR SIZE 2 MOD PACKAGE UNIT CONDENSER SUPPORT SEPARATE 120V WIRING PACKAGE (REQUIRED AND USED ONLY FOR DCV OR PREWIRE WITH VFD) - THREE PHASE ONLY SIZE 2 COOLING COIL ECOATING OPTION FOR STANDARD MPU, DX AND CHILLED WATER COILS CONDENSING UNIT LOCKING CAPS FOR SINGLE HEAT PUMP CONDENSER UNITS 2 YEAR PARTS WARRANTY FAN UNIT NO TAG QTY DESCRIPTION 1 YES FAN UNIT NO TAG EXHAUST GREASE CUP GRAVITY DAMPER WALL MOUNT SUPPLY SIDE DISCHARGE GRAVITY DAMPER MOTORIZED DAMPER WALL MOUNT 1 2 # 1 # 2 34 LBS 83 LBS CURB CURB 26.500"W X 26.500"L X 26.000"H 0.250:12.000 PITCH ALONG LENGTH, RIGHT VENTED HINGED. 31.000"W X 121.000"L X 20.000"H 0.250:12.000 PITCH ALONG WIDTH, RIGHT INSULATED MPU CURB CLIPS. NO ON FAN WEIGHT ITEM SIZE - VARIABLE SPEED CONTROL. - THERMAL OVERLOAD PROTECTION (SINGLE PHASE). - HIGH HEAT OPERATION 300°F (149°C). EXHAUST FAN MUST OPERATE CONTINUOUSLY WHILE EXHAUSTING AIR AT 300°F (149°C) UNTIL ALL FAN PARTS HAVE REACHED THERMAL EQUILIBRIUM, AND WITHOUT ANY DETERIORATING EFFECTS TO THE FAN WHICH WOULD CAUSE UNSAFE OPERATION. NORMAL TEMPERATURE TEST 26" 28" 37 3/8" 16 1/2" 2" 22 5/8" - INTERNAL WIRING. - ROOF MOUNTED FANS. - RESTAURANT MODEL. FEATURES: - DIRECT DRIVE CONSTRUCTION (NO BELTS/PULLEYS). - NEMA 3R SAFETY DISCONNECT SWITCH. 33 3/4" GREASE DRAIN. - GREASE CLASSIFICATION TESTING. - UL705 AND UL762 AND ULC-S645 ABNORMAL FLARE-UP TEST EXHAUST FAN MUST OPERATE CONTINUOUSLY WHILE EXHAUSTING BURNING GREASE VAPORS AT 600°F (316°C) FOR A PERIOD OF 15 MINUTES WITHOUT THE FAN BECOMING DAMAGED TO ANY EXTENT THAT COULD CAUSE AN UNSAFE CONDITION. 3" FLANGE. 26" 26" ROOF OPENING DIMENSIONS. 20 GAUGE CONSTRUCTION. STEEL 26" 26 1/2" 26 1/2" VENTED CURB. EXAMPLE: 7/12 PITCH = 30° SLOPE. PITCHED CURBS ARE AVAILABLE FOR PITCHED ROOFS. SPECIFY PITCH: 1/4" 1° 12" FAN #1 DU180HFA - EXHAUST FAN OPTIONS GREASE BOX. FAN BASE CERAMIC SEAL - SHIP LOOSE - FOR GREASE DUCTS. MIAMI DADE CERTIFICATION - NOA-1 ALUMINUM UPBLAST. 2 YEAR PARTS WARRANTY. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233INSTALLATION FASTENER TYPES FAN TO CURB WOOD (SG = 0.42 MIN.)STEEL (12 GAUGE MIN.) CONCRETE (2500 PSI MIN. CRACKED CONCRETE) FASTENER 5/16"-18 X 2" SELF DRILLING SCREW (ELCO DRIL-FLEX OR BETTER) 3/8" DIA. ZINC PLATED LAG BOLT 1/4"-14 DRIL-FLEX SELF DRILLING SCREW 3/8" DIA. SS HILTI KWIK BOLT TZ EXPANSION ANCHOR MINIMUM THREAD PENETRATION N/A 2-1/2"12 GAUGE 2" MINIMUM EDGE DISTANCE N/A 1-1/2"3/8"3" MINIMUM END DISTANCE N/A 2-5/8"3/8"3" MINIMUM SPACING N/A 1-1/2"3/4"5-1/2" INSTALLATION FASTENER QTY CURB TO FAN (ROOF) CURB TO FAN (WALL)WOOD (ROOF) WOOD (WALL) STEEL (ROOF) STEEL (WALL) CONCRETE (ROOF) CONCRETE (WALL) FAN MODEL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL DU180 3 12 3 12 5 20 5 20 6 24 6 24 5 20 5 20 LISTED GREASE DUCT. EXHAUST FAN. § HIGH TEMP GASKET IS USED TO SEAL THE FAN TO THE TRANSITION PLATE. VENTED CURB ROOF TERMINATION. THE INNER DUCT IS FULLY WELDED TO THE TRANSITION PLATE, ALL WELDS ARE DYE TESTED. SECURED TO THE CURB BY OTHER. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-9 121" FLEX CONDUIT FOR FIELD WIRING. BLOWER DISCHARGE. 16" 10" 18 3/4" 8 5/8" LIFTING LUG. AIRFLOW. BLOWER/MOTOR ACCESS DOOR 24" SERVICE CLEARANCE REQ. SERVICE DISCONNECT SWITCH. AIRFLOW. COOLING COIL MODULE. 1" MPT CONNECTION FOR SS PITCHED DRAIN PAN. COIL ACCESS DOOR.AIRFLOW. DISCONNECT. CONDENSER 33 1/16"HEAT PUMP 1 AIRFLOW. 49 3/8" 16 1/4" 31" 20" EQUIPMENT CURB. 40 1/8" 36 3/4" 42 1/8" 47 3/4" 49 3/8" 82 1/4" 42 1/8" 178" MIN. 20" MINIMUM STRAIGHT DUCT PER AMCA* FAN #2 A2-20D-MPU - SUPPLY FAN 1. SUPPLY UNIT WITH 20" MIXED FLOW DIRECT DRIVE FAN IN SIZE #2 HOUSING. 2. INTAKE HOOD WITH EZ FILTERS. 3. DOWN DISCHARGE - AIR FLOW RIGHT -> LEFT. 4. DOWN DISCHARGE CONSTRUCTION FOR SIZE 2 UNTEMPERED DIRECT DRIVE AHUS. 5. MIAMI DADE IMPACT AND WIND LOAD CERTIFICATION +30 / -130 PSF - MIAMI DADE COUNTY PRODUCT CONTROL APPROVED. FLORIDA BUILDING CODE APPROVAL. ROOF MOUNT EXHAUST CURBS UP TO 20" HIGH MUST BE 18 GAUGE ALUMINIZED. 6. 5 TON, SINGLE CIRCUIT MODULAR PACKAGED COOLING OPTION WITH HEAT PUMP FOR SIZE 2 MODULAR PACKAGED UNIT. INCLUDES HEAT PUMP, DX COIL, FILTER/DRYER KIT, THERMAL EXPANSION VALVE, R410A REFRIGERANT, AND REFRIGERANT PIPING. (2,000 TO 3,000 CFM) WHEN ORDERED WITH OPPOSITE AIRFLOW CONDENSERS ACCESS AND COIL PIPING WILL REMAIN IN STANDARD POSITION. DRAIN AND SLEDS WILL MOVE TO THE OPPOSITE SIDE. ANY OTHER CHANGE WILL REQUIRE CLI. CONDENSERS REQUIRE SEPARATE 208V, 3 PHASE POWER SUPPLY UNLESS ORDERED WITH SINGLE POINT CONNECTION. COIL = 3EZ1001R. 7. INSULATED BLOWER HOUSING SIZES 1-2 COMMERCIAL MODULAR. 8. CONTROL PACKAGE FOR MOD PACKAGE UNIT HEAT PUMP UNIT. INCLUDES AIRFLOW PROVING SWITCH, RTULINK-ACHP BOARD AND TERMINAL BLOCKS. 9. SUPPORT SHELL FOR SIZE 2 MODULAR PACKAGE UNIT. INCLUDES CONTROL VESTIBULE. INCLUDES CONDENSER SUPPORTS. DOES NOT INCLUDE RETURN AIR OR INLET AIR DAMPER. 10. SEPARATE 120VAC WIRING PACKAGE FOR MAKE-UP AIR UNITS. OPTION MUST BE SELECTED WHEN MOUNTING VFD IN PREWIRE PANEL OR WITH DCV PACKAGE. PROVIDES SEPARATE 120VAC INPUT TO SUPPLY FAN. THIS 120V SIGNAL MUST BE RUN BY ELECTRICIAN FROM DCV TO MUA SWITCH. 11. SIZE 2 COOLING COIL ECOATING OPTION FOR STANDARD MPU, DX AND CHILLED WATER COILS. ADDS 5-6 WEEK LEAD TIME. 12. LOCKING CAPS FOR SINGLE HEAT PUMP CONDENSER UNITS. CONSISTS OF 3 LOCKING CAPS, PART# NCP-4, AND 1 KEY, PART# NC-KEY. 13. HINGED DOUBLE WALL INSULATED DOOR ASSEMBLY (BURNER/BLOWER/MPU SECTION). 14. 2 YEAR PARTS WARRANTY *NOTE: SUPPLY DUCT MUST BE INSTALLED TO MEET SMACNA STANDARDS. A MINIMUM STRAIGHT DUCT LENGTH MUST BE MAINTAINED DOWNSTREAM OF UNIT DISCHARGE AS OUTLINED IN AMCA PUBLICATION 201. WHEN USING RECTANGULAR DUCTWORK, ELBOWS MUST BE RADIUS THROAT, RADIUS BACK WITH TURNING VANES. FLEXIBLE DUCTWORK AND SQUARE THROAT/SQUARE BACK ELBOWS SHOULD NOT BE USED. ANY TRANSITION AND/OR TURNS IN THE DUCTWORK WILL CAUSE SYSTEM EFFECT. SYSTEM EFFECT WILL DRASTICALLY INCREASE STATIC PRESSURE AND REDUCE AIRFLOW. DO NOT RELY ON UNIT TO SUPPORT DUCT IN ANY WAY. FAILURE TO PROPERLY SIZE DUCTWORK MAY CAUSE SYSTEM EFFECTS AND REDUCE PERFORMANCE OF THE EQUIPMENT. SUGGESTED STRAIGHT DUCT SIZE IS 20" x 20". L ETS DI R ROOF OPENING 2" SMALLER THAN CURB DIMENSION. EXAMPLE: 7/12 PITCH = 30° SLOPE. PITCHED CURBS ARE AVAILABLE FOR PITCHED ROOFS. SPECIFY PITCH: 1/4" 1° 12" 12" MIN. 7" CLEAN OUT. TYPICAL DRAIN TRAP INSTALL NO UNIONS. RECOMMENDED COOLING COIL DRAIN TRAP CONFIGURATION. NOTES: 1) 1" DIAMETER PVC PIPE ONLY. 2) USE ONLY LOW PROFILE COUPLINGS. 3) ADD CLEAN OUT AS SHOWN. 6" 6" SW-01 BK MT-01 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 GR GR Label Description Location MT-01 Supply motor [2] SW-01 Main disconnect switch [2] Component Identification 23 BK BK BK BK BK Installed Options RD - RED BL - BLUE WH - WHITE OR - ORANGE BR - BROWN BK - BLACK PK - PINK PR - PURPLE GY - GRAY GR - GREEN YW - YELLOW WIRE COLOR DENOTES INTERNAL WIRING DENOTES FIELD WIRING NOTES 7 8RD(DCV SF1)WH (DCV N1) DCV/VFD Wiring (MAY NOT BE NEEDED DEPENDING ON OPTIONS) IF DCV IS NOT PRESENT, RD AND WH WIRES FROM SEPARATE 120VAC SOURCE Cooling Transformer(40va)TR-05 [4] BK WH 1 TR-05115 BL 24 YW N RCR1 BK RD WH WH MOCP = 10 AMPS FOR CONTROL WIRING DROP FOR DISCONNECT CONNECTION !ATTENTION ELECTRICIAN! CONNECT POWER TO THE DROP RC PS-01 R1 BK NOCNC C BL R TS-06 TS-06 RTUlink-ACHP [16] [20]Outside Air SensorSN-01 PS-01 DDP-106-313 AFS [17] 1 2 5 6 3 4 6 10 SW-02 2 208/230 3 PHASE GR BL BL BL 9 5 1 HEAT PUMP 1 R1BK BL BL BL C RC R 13 11 RD SW-02 40 Amp Rotary Disconnect [18][15] SW-06 [16-17]Overflow Switch SW-06 FL R1 Alarm 1 Airflow SN-01 BK OB GY OR W1RD SN-02 BK [20]Discharge Air SensorSN-02 O Y OB Y1 BL GY W2 W1RD Y1 W1 + C + C OutsideTemp DischargeTemp O/B BL BL YW RDRD RD BK COOL STAGE ON TIMER = 2 MIN. COOL STAGE OFF TIMER = 2 MIN. COOL HYSTERESIS = 1 MIN. STANDARD PARAMETERS CONTROL MODE = AUTOSTAGE BASED ON = OUTSIDEACTIVATE BASED ON = OUTSIDE MODE CHANGE TIME = 5 MIN. ONE HEAT PUMP STAGE 1 COOLING SETPOINT = 85°F TWO HEAT PUMPS STAGE 1 COOLING SETPOINT = 85°F STAGE 2 COOLING SETPOINT = 95°F THREE HEAT PUMPSSTAGE 1 COOLING SETPOINT = 85°FSTAGE 2 COOLING SETPOINT = 90°FSTAGE 3 COOLING SETPOINT = 95°F HEAT HYSTERESIS = 1 MIN. HEAT STAGE ON TIMER = 2 MIN. HEAT STAGE OFF TIMER = 2 MIN. O/B MODE = ENERGIZE WITH COOL STAGE 1 HEATING SETPOINT = 55°F STAGE 1 HEATING SETPOINT = 55°FSTAGE 2 HEATING SETPOINT = 45°F STAGE 1 HEATING SETPOINT = 55°FSTAGE 2 HEATING SETPOINT = 50°F STAGE 3 HEATING SETPOINT = 45°F IS FACTORY SUPPLIED Y1 SUPPLY 1HP-230V-3P-3.4FLA MOTOR INFO ELECTRICAL INFORMATIONMOTOR CIRCUIT MCA: 4.3ACONTROL CIRCUIT MCA: 1.0A MOTOR CIRCUIT MOP: 15ACONTROL CIRCUIT MOP: 15A DRAWING NUMBER JOB MODELSHIP DATEA5599506-2 5599506 - Island Donuts (CAS tempered) 8/15/2022 SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-10 1 DCV-1111 UTILITY CABINET LEFT 03 - UTILITY CABINET LEFT HOOD # 1 1 LIGHT 1 FAN SMART CONTROLS DCV EXHAUST SUPPLY 3 3 2.000 1.000 230 230 7.5 3.4 NO TAG PACKAGE #LOCATION SWITCHES LOCATION QUANTITY OPTION FANS CONTROLLED TYPE ɸ HP VOLT FLA DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-1 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. BREAKER PANEL TO PRIMARY CONTROL PANEL Responsibility: Electrician BREAKER PANEL PRIMARY CONTROL PANEL BREAKER SIZE SHOWN IS THE MAXIMUM ALLOWED BREAKER 1PH CONTROL POWER. DO NOT WIRE TO GFCI OR SHUNT TRIP BREAKER. Hot Neutral H1 N1120 V 15 A Ground GND 1ST HOOD LIGHT BREAKER SHARED W/ CONTROL POWER. SWITCH #1 WIRE TO VFD QUICK CONNECTOR BREAKER 3PH MCA: MOCP: LINE LINE Ground EXH-1 SM-1 GND L1 L2 LINE L3230 V 9.4 A 20 A BREAKER 3PH WIRE TO VFD QUICK CONNECTOR MCA: MOCP: LINE LINE 230 V Ground SUP-2 SM-2 GND L4 L5LINEL64.2 A 15 A BREAKER PANEL TO FANS Responsibility: Electrician BREAKER PANEL FANS POWER TO CONDENSER LINE LINE208-230 30 Amps SUP-2 LINE COND 1 3 PHASE CONTROL PANEL TO FANS Responsibility: Electrician PRIMARY PANEL FANS Load Wiring WIRE TO VFD QUICK WIRE TO DISCONNECT CONNECTOR MUST HAVE ITS OWN CONDUIT DO NOT SHARE CONDUIT! FLA: HP: VOLT: EXH-101LOAD LEG 1 LOAD LEG 2 GND GROUND FAN: SM-1 LOAD LEG 3 U1 V1 W1 7.5 2.000 230 V Load Wiring BLACK BLACK BLACK GREEN WIRE TO VFD QUICK CONNECTOR WHITE RED FLA: HP: VOLT: MUST HAVE ITS OWN CONDUIT DO NOT SHARE CONDUIT! IF VFD MOUNTED IN 2ND PANEL, WIRE SF SIGNAL FROM PANEL WITH ECPM03. U2 V2 W2 LOAD LEG 1 LOAD LEG 2 LOAD LEG 3 GND GROUND SUP-202FAN: SM-2 N1 120V NEUTRAL 120V HOT N1 3.4 1.000 230 V H1 CONTROL PANEL TO ACCESSORY ITEMS Responsibility: Electrician CONTROL PANEL COMPONENT ALL SWITCHES FACTORY WIRED CAT-5 CONNECTION CONTROL PANEL SWITCHES TO J4 CONTROL PANEL HOOD LIGHTS TO 1400 W MAX WIRE TO J-BOX ON TOP OF HOOD B1 W1 GND BLACK WHITE GREEN HOOD LIGHTS 1 WIRE TO CONTROL BOARD. INSTALL SENSOR IN ROOM AWAY FROM HEAT SOURCES. DO NOT INSTALL SENSOR CONTROL PANEL KITCHEN TEMP TO SENSOR ON THE CEILING GRID, SEE MANUAL. T1A T1B ROOM TEMP FACTORY WIRED TEMPERATURE SENSOR. MOUNTED IN EXHAUST DUCT CONTROL PANEL DUCT SENSOR TO T2A T2B HOOD 1 RISER 1 CONTROL PANEL GAS VALVE TO 120V ONLY ONLY ENERGIZED THROUGH LCD HMI WHEN FIRE SYSTEM ARMED. GAS N1 HOT TO GAS VALVE NEUTRAL GAS SOLENOID THE FOLLOWING CONNECTIONS MAY OR MAY NOT BE REQUIRED BASED ON JOBSITE SPECIFICATIONS CONTROL PANEL EXTERNAL SIGNAL FOR SHUNT TRIP ST TERMINAL IS ENERGIZED IN FIRE CONDITION. CONTROL PANEL EXTERNAL SIGNAL FOR CONTACTOR COIL KS TERMINAL IS DE-ENERGIZED IN FIRE CONDITION. ST N1 NEUTRAL FROM SHUNT COIL HOT TO SHUNT COIL SHUNT COIL KS N1 NEUTRAL_TO_CONTACTOR_COIL HOT_TO_CONTACTOR_COIL CONTACTOR_COIL SPARE CONTACTS WILL MAKE CONTROL PANEL ON/OFF WITH DRY CONTACT SUPPLY FAN COMMON TO NORMALLY OPENWHEN SUPPLY FAN IS ON. GROUP 1 SFC1 SFO1 COMMON NORMALLY OPEN SFC2 SFO2 COMMON NORMALLY OPEN WIRE TO ECPM03 TERMINALS. CONFIGURABLE OUTPUT. DCV SPEED (TOTAL) 0-10V OUTPUT ON PCB SEE ECPM03 OWNERS MANUAL. TO BMS + -VO+ VO- WIRE TO VFD TERMINAL STRIP.PROPORTIONAL TO FREQUENCY. VFD ANALOG (EACH VFD) 0-10V OUTPUT IN VFD SEE VFD OWNERS MANUAL. TO BMS + -30 2 CONTROL PANEL EXTERNAL TO SWITCH SIGNAL SWITCH THROUGH BMS WILL ACTIVATE ZONE1 FANS AND LIGHTS H1 IO1 BMS SWITCH C NO CONTROL PANEL GAS VALVE TO 24V DC ONLY ONLY ENERGIZED THROUGH LCD HMI WHEN FIRE SYSTEM ARMED. (NOT NEEDED IF USING 120V GAS VALVE). LGV N1D POSITIVE TO GAS VALVE NEGATIVE GAS SOLENOID SYSTEM DRY SPARE FIRE CONTACT CONTROL PANEL SPARE CONTACTS WILL MAKE C2 TO AR2 WHEN SYSTEM IS ARMED. THEY ARE USED TO DISABLE EQUIPMENTOR PROVIDE SIGNALS. (NOT FOR BUILDING FIRE ALARM WHICH MUST BE WIRED DIRECTLY TO THE ANSUL ALARM INITIATING SWITCH LOCATED IN ANSUL AUTOMAN) C2 AR2 COMMON NORMALLY OPEN CONTROL PANEL TO FIRE SYSTEM Responsibility: ALARM CONTRACTOR CONTROL PANEL COMPONENT CONTROL PANEL BUILDING SIGNAL FOR FIRE ALARM PANEL AL1 AL2 J9 BUILDING ALARM PANEL FIRE INPUT WIRE DIRECTLY TO CORE CIRCUIT BOARD. AL1 WILL MAKE AL2 IN FIRE CONDITION. CONTROL PANEL BUILDING SIGNAL FOR TROUBLE TROUBLE RELAY CONTACTS WILL MAKE TBC TO TBL IN TROUBLE CONDITION. BUILDING ALARM PANEL ALARM TBC TBL COMMON NORMALLY CLOSED DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-2 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. CONTROL PANEL TO FIRE SYSTEM Responsibility: CERTIFIED INSTALLER CONTROL PANEL COMPONENT FIRE STAT SUPERVISED LOOP May be mixed factory and field wiring. See Installation Schematic. Multiple fire sensors possible. HIGH TEMP WIRE (842 F), PN: SLPCON-xFT required for all Supervised Loop wiring in contact with a hood. All other wiring shall be PN: 6320UL, Belden or similar. 21 22 23 24 FS-01 BK WH Fire Stat FS-02 BK WH Fire Stat CONTROL PANEL MOUNTED FIRE TO DUCT DETECTION STAT(S) FIRE STATS CONTROL PANEL SYSTEM PULL TO FIRE STATION MANUAL ACTUATION LOOP / REMOTE FIRE SYSTEM LOOP. Multiple manual actuation possible. Multiple manual actuation possible. A Plug jumper with wires from pin1 to pin4 and from pin2 to pin3 is mounted on J10, remove the jumpers and wire in the supervised actuation loop. Microswitch MS-01 is optional for fire system interlock. Auxiliary Interlock (AUX-01): Wire AU1 / AU2 of adjacent Master FS panel(s) in each manual activation loop for simultaneous activation. See Fire system drawings for more information. 101 102 103 104 AUX-01 AU1 AU2 PULL STATION MS-01 C NO Micro SW MAD-01C NO Manual ActuationDevice Adjacent FS Panel CAT-5 CONNECTIONCONTROL PANEL MASTER FS TO BOARD. PLACE END OF LINE PLUG EOL120AIN EMPTY JACK. PN: EOL120A CORE PCB ADDITIONAL DEVICES MAY BE INLINE. ECPM03 UNLESS VFD, PCU, OR OTHER COMPONENT IN SERIES. J3 J5 J6 CONTROL PANEL MASTER FS TO PANEL WIRE TO LIKE TERMINALS IN ALL CORE PANELS THAT MUST ACTIVATE TOGETHER. SET MASTER & SLAVE DIP SWITCHES PER FIRE SYSTEM SHIELDED TWISTED PAIRINTERLOCK NETWORK MASTER CORE MANUAL. CA CB CC BLACK RED SHIELD CA CB CC SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-11 DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-3 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-4 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-12 DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-5 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER WH BK A B C D E F G H I 1 2 3 4 5 6 7 8 9 10 MOTOR POWER CIRCUIT PANEL LID COMPONENT LIST LABEL DESCRIPTION ST-X varies Starter OL-X varies Overload C-X varies Contactor TS-x A/CP-PO-T4"-EXPL Duct Thermostat 120 VAC RELAY RA-x 24 VDC RELAY RD-x PS-1 MDP18-24A-1C Power Sup. 24VDC BK RA-x 34.110.0184.0 120V Relay DPDT WH RA-x 34.110.0184.0 120V Relay DPDT GR UNLESS SPECIFIED OTHERWISE, ALL FACTORY AC WIRING 16 AWG. ALL FACTORY DC WIRING 18 AWG. N1 H1 DC-GNDDC+8H1 7PCU 6ST 5KS 4KTS 3GAS 2AR1 1N1 120VJ9 5OV1 4SF1 3EF1 2B1 1IO1 120VJ7 AR1 H12x N12x B1 EF1 SF1 BK IO1 BK BK BK JUMPERW1 BK 14AWG BK 64 RD-1 BL PRDC+RO1 RD-x 34.110.0188.0 24VDC Light Relay BK WHSF1RA-2 RD-1 24V 1 2 3 4 5 6 7 8 9 1011121314 J6 N1N1RO1 FAN PANEL COOLING DRY CONTACTS (SHOWN DE-ENERGIZED) HOOD LIGHTS J3 ECPM03/DAISY CHAIN AR1 H1JUMPER FIRE SYSTEM BK BK BK GAS KS ST NOTE: Configure ECPM03 for CORE SM-1 SM-2 ECPM03 J10 IL1AIL1BJUMPER MAKE UP AIR INTERLOCK. 1 2 11 1 JUMPER 1 2 11 1 JUMPER NOTE: All items on ECPM03 J3 line to be daisy chained from one component to the next, with EOL120A at end of line. Place PN: EOL120A in empty RJ45 port. J3 ECPM03 or Previous EOL J5 MASTER CORE RA-2-1 SFC1 SFO1 14 AWG YW RA-2-2 SFC2 SFO2 14 AWG YW FACTORY WIRING SCHEMATIC CIRCUIT BOARDS ECPM03 DCV Rev. 2.14.00 HMI Rev. 2.14.00 SC-24 X 18 X 8.62 BOX CONTROL INPUT 120V H1=LINE, N1=NEUTRAL, 15A BREAKER. DO NOT CONNECT TO SHUNT TRIP BREAKER. SEE INSTALLATION SCHEMATIC FOR ADDITIONAL REQ. NOTE: IF VFD HAS 1PH 240V INPUT, USE L1 & L2 ONLY. IF VFD HAS 1PH 120V INPUT, USE L1 & N ONLY. LEGEND FIELD WIRING FACTORY WIRING BK- BLACK BL- BLUE BR- BROWN OR- ORANGE WH- WHITE OR/BL- OR/BL STRIPE BL/RD- BL/RD STRIPE RD/GN- RD/GN STRIPE WH/BL- WH/BL STRIPE YW- YELLOW GY- GREY PR- PURPLE RD- RED GR- GREENWH/BLBLH1N1DC-DC+LN - + PS-01 AC 24V GNDDCKSKSBKKS BK BK GAS ST BKEF1 PRWH GR/YWWH/BLBLJ4 J5 FAN SECONDARY PANEL COOLING IF NECESSARY EF1 WHBK JUMPER ECPM03 J10 IL2AIL2BTERMINAL GAS USED FOR 120V POWERED GAS VALVES ONLY 5599506 Island Donuts (C... FACTORY DCV-1111 8/15/2022 ECP #1-6 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. BK BK BK BK BK BK BK BK BK BK BK BK U/T1 V/T2 W/T3 L1 L2 L3/N GR GR GND VFD: HP: MTR: FLA: P107: P108: P410: P150: P100: P194: P101: P131: P167: P103: P102: L1 L2 L3 14 AWG 3 PH 20 A 230 V U1 V1 W1 SM-1 ESV222N02YXB571 225 01 01 11 78 01 7.5 2.000 EXH-1 N/A N/A 73.4 73.4 0.0 GND BK BK BK BK BK BK BK BK BK BK BK BK U/T1 V/T2 W/T3 L1 L2 L3/N GR GRGND VFD: HP: MTR: FLA: P107: P108: P410: P150: P100: P194: P101: P131: P167: P103: P102: L4 L5 L6 14 AWG 3 PH 15 A 230 V U2 V2 W2 SM-2 ESV751N02YXB571 225 01 01 21 80 01 3.4 1.000 SUP-2 N/A N/A 63.6 63.7 0.0 GND SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-13 A B C D E F G H I 1 2 3 4 5 6 7 8 9 10 FACTORY WIRING SCHEMATIC CORE FIRE PROTECTION COMPONENT LIST LABEL DESCRIPTION 120 VAC RELAY RA-x 24 VDC RELAY RD-x 24 VOLT BATTERY PACK5 AMP FUSE RD SHIELDED TWISTED PAIR PCB-2 J3-2 J4-1 J3-11 J4-3 J4-2 J4-8 J4-9 J4-12 J3-14 J4-5 J3-13 J3-4 J4-6 J3-10 J2-1 J2-2 J2-3 J2-4 J7-2 J7-3 J7-1 J3-1 J3-3 RD RD BR RD ALL 18AWG RD BK ORRD PKRD BRRD RD OR/BL BK 18AWG BK BK J3-5 J1-1 J1-2 RD BK BK RD FIRE STAT SUPERVISED LOOP May be mixed factory and field wiring. See Installation Schematic. Multiple fire sensors possible. + + RD BK BK RD Shield BK RD RS-485 CORE INTERLOCK NETWORK. Connection to other CORE Panels or Communication Module. See Installation Schematic for Connection. N1D 3xH1D3x DISCONNECT J1 21 22 23 24 16AWG WHN1 H1 PN: 1606-XLP-60EQ Adjust power supply to 27.5 Volts with an accurate Digital Volt Meter or with an HMI plugged into the CORE board. NL +-PSM-2 60W GR BK GND PCB-2 PCBCORE-APP CORE PCB PSM-2 1606-XLP-50E CORE POWER SUPPLY WS-x varies Water Solenoid LT-06 PNL-1163-0UR 24V Red Ind. Light LL-01 AQ5510 Surf. Level Sensor AA-01 SCE120LA3FP1B Audible Alarm PB-01 D7-F2X11 Prime/Reset Switch SW-04 BZ-2RQ1-A2Tamper Switch SP-1 50000-805Surfactant Pump PB-01 Prime / Reset RD-20 Trouble Relay RD-17 Fire Relay DRY CONTACTS (SHOWN DE-ENGERGIZED) AA-01 Audible Alarm SW-04 Door Tamper Switch C NO FS-01 BK WH Fire Stat FS-02 BK WH Fire Stat HIGH TEMP WIRE (842 F), PN: SLPCON-xFT required for all Supervised Loop wiring in contact with a hood. All other wiring shall be PN: 6320UL, Belden or similar. Factory mounted hood sensors will be terminated at junction box on top of hood. GV-1 varies 24v DC Gas Valve INTERLOCK FOR AUTOMAN ACTIVATION. Used for activating 120V automan or adjacent Master CORE panels during active Fire Condition. RD-18-1 YW J3-16 J3-8 BR 38 LT-6 R FIRE INDICATOR DIP Switch ATTENTION: LOW-VOLTAGE DC OR SIGNALING WIRE SHOULD BE ROUTED IN SEPARATE CONDUIT FROM ALL AC SOURCES. RD/GNRDRD-19 Equipment Relay COOKING EQUIPMENT DISABLE RELAY. For UDS Kill Switch, wire EKC and EKS terminals to like terminals in UDS panel. RD-19-1 EKC EST EKS YW INTERLOCK FOR AUTOMAN ACTIVATION. Used for activating 120V automan or adjacent Master CORE panels during active Fire Condition. RD-18-1 YW RD OR/BLRD-18 Auxiliary Interlock Relay FS-XX 12-F28021-000360 Duct Fire Sensor LT-05 PNL-1163-0UY 24V YLW Ind. Light PS-01 Station STI-SS2431 Remote Puill/Push FOR SHIPMENT J10-1 J10-2 J10-3 J10-4 RD BK BK RD 101 102 103 104 MANUAL ACTUATION LOOP / REMOTE FIRE SYSTEM LOOP. Multiple manual actuation possible. A Plug jumper with wires from pin1 to pin4 and from pin2 to pin3 should be mounted on J10 if there is no manual actuation device and no microswitch. Jumper if water valve supervision switch is used MAD-01C NO Manual Actuation Device MS-01 C NO Micro SW 1 2 3 4 5 6 7 8 SW1OPEN PUT END OF LINE PLUG IN EMPTY RJ45 J3 ECPM03 UNLESS PCU AFM OR OTHER COMPONENT IN SERIES. CAT-5 WIRING (MASTER ONLY) FIELD WIRED IF REMOTE PREWIRE RD-XX PLC-RPT-24DC/21 24VDC Phoenix Relay AUX-01 AU1 AU2 Auxiliary Interlock (AUX-01): Wire AU1 / AU2 of adjacent Master CORE panel(s) in each manual activation loop for simultaneous activation. AU1/AU2 will have continuity for 10 seconds if adjacent panel goes into fire condition, activating this CORE Panel but allowing for a reset after 10 seconds. NOTE: AU1/AU2 terminals of CORE Panel should not be wired into its own manual activation loop.Adjacent CORE Panel Master CORE set DIP SW 8 to CLOSED position. Slave CORE with address 1 set DIP SW 8 to CLOSED position. All other CORES set DIP SW 8 OPEN. 18AWG LEGEND FIELD WIRING FACTORY WIRING BK- BLACK BL- BLUE BR- BROWN OR- ORANGE WH- WHITE OR/BL- OR/BL STRIPE BL/RD- BL/RD STRIPE RD/GN- RD/GN STRIPE WH/BL- WH/BL STRIPE YW- YELLOW GY- GREY PR- PURPLE RD- RED GR- GREEN FIRE INDICATOR FAULT CONDITION FLASH CODES 2 Release Solenoid 3 Pressure Switch 4 Auxiliary Fault 5 Microcontroller Fault 6 N/A 7 Supervised Loop 8 Ground Fault 9 Surfactant Low 10 Battery Voltage Low 11 AC Power Failure 12 Door Tamper Switch 13 Test Mode 14 CORE Interlock Network 15 Fault on Hood in Interlock Network 16 Fault on PCU in Interlock Network FIRE ALARM SYSTEM DRY CONTACTS. Termials AL1 & AL2 make in FIRE. To Building Fire Alarm Panel J9 AL1 AL2 J3-7 FIRE SYSTEM DRY CONTACTS. Dry contacts will make C2 to AR2 when system is armed. RD-17-1 C2 AR2 14 AWG YW TROUBLE RELAY. Contact terminals TBC & TBL make if there is trouble. Contact terminals TBC & TOK make if the system is ok. RD-20-1 TBC TBLTOK YW RD PS OR J4-9 PS EWC-PRESSUREPressure Switch PR RS SW-05-1 Test Armed 3 4 YW RS-1 RELEASE SOLENOID BLBR RD ORSW-05-2 Test Armed3 4 J4-13 SW-05 ZB5AD2TEST/ARM Switch RS2PRSW-05-1 Test Armed 3 4 YW PS-1 Pressure Switch WH PWS-01 24VDC 18W POWER 24VDC Power Suppl CA CB CC AU1AU1 AU2AU2 TR2 MAD-01 DEVICEMANUAL ACTIVATION GAS VALVES SHOULD BE WIRED TO MASTER CORE BOARD ONLY. RDRD GV-1 24V DC Gas ValveLGVPK TERMINAL LGV USED FOR 24VDC POWERED GAS VALVES ONLY. 5599506 Island Donuts (C... FACTORY DCV-1111 8/15/2022 ECP #1-7 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-14 CONTROL PANEL. LCD INTERFACE. DUCT TEMPERATURE SENSOR. ROOM TEMPERATURE SENSOR. DEMAND CONTROL VENTILATION HOOD CONTROL PANEL SPECIFICATIONS: - CONTROLS SHALL BE LISTED BY ETL (UL 508A) AND SHALL COMPLY WITH DEMAND VENTILATION SYSTEM TURNDOWN REQUIREMENTS OUTLINED IN IECC 403.2.8 (2015). - THE CONTROL ENCLOSURE SHALL BE NEMA 1 RATED AND LISTED FOR INSTALLATION INSIDE OF THE EXHAUST HOOD UTILITY CABINET. THE CONTROL ENCLOSURE MAY BE CONSTRUCTED OF STAINLESS STEEL OR PAINTED STEEL. - TEMPERATURE PROBE(S) LOCATED IN THE EXHAUST DUCT RISER(S) SHALL BE CONSTRUCTED OF STAINLESS STEEL. - A DIGITAL CONTROLLER SHALL BE PROVIDED TO ACTIVATE THE HOOD EXHAUST FANS DYNAMICALLY BASED ON A FIXED DIFFERENTIAL BETWEEN THE AMBIENT AND DUCT TEMPERATURES SENSORS. THIS FUNCTION SHALL MEET THE REQUIREMENTS OF IMC 507.1.1. - A DIGITAL CONTROLLER SHALL PROVIDE ADJUSTABLE HYSTERESIS SETTINGS TO PREVENT CYCLING OF THE FANS AFTER THE COOKING APPLIANCES HAVE BEEN TURNED OFF AND/OR THE HEAT IN THE EXHAUST SYSTEM IS REDUCED. - A DIGITAL CONTROLLER SHALL PROVIDE AN ADJUSTABLE MINIMUM FAN RUN-TIME SETTING TO PREVENT FAN CYCLING. - VARIABLE FREQUENCY DRIVES (VFDS) SHALL BE PROVIDED FOR FANS AS REQUIRED. THE DIGITAL CONTROLLER SHALL MODULATE THE VFDS BETWEEN A MINIMUM SETPOINT AND A MAXIMUM SETPOINT ON DEMAND. THE DUCT TEMPERATURE SENSOR INPUT(S) TO THE DIGITAL CONTROLLER SHALL BE USED TO CALCULATE THE SPEED REFERENCE SIGNAL. - THE VFD SPEED RANGE OF OPERATION SHALL BE FROM 0% TO 100% FOR THE SYSTEM, WITH THE ACTUAL MINIMUM SPEED SET AS REQUIRED TO MEET MINIMUM VENTILATION REQUIREMENTS. - AN INTERNAL ALGORITHM TO THE DIGITAL CONTROLLER SHALL MODULATE SUPPLY FAN VFD SPEED PROPORTIONAL TO ALL EXHAUST FANS THAT ARE LOCATED IN THE SAME FAN GROUP AS THE SUPPLY FAN. - THE SYSTEM SHALL OPERATE IN PREP MODE DURING LIGHT COOKING LOAD OR COOL DOWN MODE WHEN SUFFICIENT HEAT REMAINS UNDERNEATH THE HOOD SYSTEM AFTER COOKING OPERATIONS HAVE COMPLETED. OPERATION DURING EITHER OF THESE PERIODS WILL DISABLE THE SUPPLY FANS AND PROVIDE AN EXHAUST FAN SPEED THAT IS EQUAL TO THE MINIMUM VENTILATION REQUIREMENT. - A DIGITAL CONTROLLER SHALL DISABLE THE SUPPLY FAN(S), ACTIVATE THE EXHAUST FAN(S), ACTIVATE THE APPLIANCE SHUNT TRIP, AND DISABLE AN ELECTRIC GAS VALVE AUTOMATICALLY WHEN FIRE CONDITION IS DETECTED ON A COVERED HOOD. - A DIGITAL CONTROLLER SHALL ALLOW FOR EXTERNAL BMS FAN CONTROL VIA DRY CONTACT (EXTERNAL CONTROL SHALL NOT OVERRIDE FAN OPERATION LOGIC AS REQUIRED BY CODE). - AN LCD INTERFACE SHALL BE PROVIDED WITH THE FOLLOWING FEATURES: A. ON/OFF PUSH BUTTON FAN & LIGHT SWITCH ACTIVATION. B. INTEGRATED GAS VALVE RESET FOR ELECTRONIC GAS VALVES (NO RESET RELAY REQUIRED). C. VFD FAULT DISPLAY WITH AUDIBLE & VISUAL ALARM NOTIFICATION. D. DUCT TEMPERATURE SENSOR FAILURE DETECTION WITH AUDIBLE & VISUAL ALARM NOTIFICATION. E. MIS-WIRED DUCT TEMPERATURE SENSOR DETECTION WITH AUDIBLE & VISUAL ALARM NOTIFICATION. F. A SINGLE LOW VOLTAGE CAT-5 RJ45 WIRING CONNECTION. G. AN ENERGY SAVINGS INDICATOR THAT UTILIZES MEASURED KWH FROM THE VFDS. SEQUENCE OF OPERATIONS: THE HOOD CONTROL PANEL IS CAPABLE OF OPERATING IN ONE OR MORE OF THE FOLLOWING STATES AT ANY GIVEN TIME: -AUTOMATIC: THE SYSTEM OPERATES BASED ON THE DIFFERENTIAL BETWEEN ROOM TEMPERATURE AND THE TEMPERATURE AT THE HOOD CAVITY OR EXHAUST DUCT COLLAR. FANS ACTIVATE AT A CONFIGURABLE TEMPERATURE DIFFERENTIAL THRESHOLD. DEPENDING ON THE JOB CONFIGURATION EACH FAN ZONE CAN BE CONFIGURED AS STATIC OR DYNAMIC. THESE TERMS REFER TO WHETHER A VARIABLE MOTOR (SUCH AS EC MOTORS OR VFD DRIVEN MOTORS) MODULATE WITH TEMPERATURE. IF THE PANEL IS EQUIPPED WITH VARIABLE SPEED FANS AND THE ZONE IS DEFINED AS "DYNAMIC", THESE WILL MODULATE WITHIN A USER-DEFINED RANGE BASED ON THE TEMPERATURE DIFFERENTIAL. PANELS EQUIPPED WITH VARIABLE SPEED FANS AND A FAN ZONE DEFINED AS "STATIC", FANS WILL RUN AT A SET SPEED CALCULATED FOR THE DRIVE. DEMAND CONTROL VENTILATION SYSTEMS ARE CAPABLE OF MODULATING EXHAUST AND MAKE UP AIR FAN SPEEDS PER THE REQUIREMENTS OUTLINED IN IECC 403.2.8. -MANUAL: THE SYSTEM OPERATES BASED ON HUMAN INPUT FROM AN HMI. -SCHEDULE: A WEEKLY SCHEDULE CAN BE SET TO RUN FANS FOR A SPECIFIED PERIOD THROUGHOUT THE DAY. THERE ARE THREE OCCUPIED TIMES PER DAY TO ALLOW FOR THE USER TO SET UP A TIME THAT IS SUITABLE TO THEIR NEEDS. ANY TIME THAT IS WITHIN THE DEFINED OCCUPIED TIME, THE SYSTEM WILL RUN AT MODULATION MODE AND FOLLOW THE FAN PROCEDURE ALGORITHM BASED ON TEMPERATURE DURING THIS TIME. DURING UNOCCUPIED TIME, THE SYSTEM WILL HAVE AN EXTRA OFFSET TO PREVENT UNINTENDED ACTIVATION OF THE SYSTEM DURING A TIME WHERE THE SYSTEM IS NOT BEING OCCUPIED. -OTHER: THE SYSTEM OPERATES BASED ON THE INPUT FROM AN EXTERNAL SOURCE (DDC, BMS OR HARD-WIRED INTERLOCK). FIRE: UPON ACTIVATION OF THE HOOD FIRE SUPPRESSION SYSTEM, THE EXHAUST FAN WILL COME ON OR CONTINUE TO TO RUN, THE HOOD MAKEUP AIR WILL SHUTDOWN, AND A SIGNAL WILL BE SENT FOR ACTIVATING THE SHUNT TRIP BREAKER PROVIDED BY THE ELECTRICIAN. FUEL GAS WILL SHUT OFF VIA A MECHANICAL/ELECTRICAL GAS VALVE ACTUATED BY THE HOOD FIRE SUPPRESSION SYSTEM. - SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-15 TAG PART #CFM GPM ZON E COVEREDBY SP WEIGHT VELOCITY QTY DESCRIPTION P1 DW1817DWLT-2R-S 3035 -0.004 27.78 1717.46 1 DOUBLE WALL DUCT - 18" INNER DUCT, 17" LONG - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P2 DW1845DWASY-2R-S 3035 -0.042 26.22 1717.46 1 DOUBLE WALL DUCT - 18" INNER 45 DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P3 DW1847DWAJD-2R-S 3035 -0.008 107.98 1717.46 1 DOUBLE WALL ADJUSTABLE DUCT - 18" INNER DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. MIN LENGTH = 11" / MAX LENGTH = 48.5" / ADJUSTMENT = 30.5" / ADJUSTABLE SECTION MAY NEED TO BE CUT. INCLUDES SINGLE AND DOUBLE WALL "V" CLAMPS. P4 DW2226SADKIT 8.80 1 DUCT - HORIZONTAL SADDLE SUPPORT KIT, USED WITH 22" OD - INCLUDES UNI-STRUT CUT TO LENGTH, DW2226SAD, & HARDWARE BAG 4. P5 ASSEMBLED W/P6 DW18DWYTEASY-2R-S 3035 -0.07 65.88 1717.46 1 DOUBLE WALL DUCT - 18" INNER Y TEE DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P6 ASSEMBLED W/P5 DW18DWACCDOORCOV-2R-S 26.16 1 DOUBLE WALL DUCT - 18" INNER ACCESS DOOR & 22" ACCESS DOOR COVER WITH CLAMPS - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P7 DW1847DWAJD-2R-S 3035 -0.009 107.98 1717.46 1 DOUBLE WALL ADJUSTABLE DUCT - 18" INNER DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. MIN LENGTH = 11" / MAX LENGTH = 48.5" / ADJUSTMENT = 30.5" / ADJUSTABLE SECTION MAY NEED TO BE CUT. INCLUDES SINGLE AND DOUBLE WALL "V" CLAMPS. P8 ASSEMBLED W/P9 DW184550DWLTTP-2R-S 3035 -0.012 75.96 1717.46 1 DOUBLE WALL DUCT - 18" INNER DUCT, 45.5" LONG - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL - USED WITH TRANSITION PLATE. P9 ASSEMBLED W/P8 DW2618TP 3035 10.58 1717.46 1 DUCT TO CURB TRANSITION, 26-1/2" CURB TO 18" DUCT, 16 GA ALUMINIZED. USED ON BDU18 & 20. SYSTEM AT P9 -1.443 0.00 3M-2000PLUS 0.80 3 DUCT - 3M FIRE BARRIER 2000 PLUS SILICONE - USED AS SEALANT TO SEAL DUCT JOINTS. DW18DWCLASY-2R-S 8.70 1 DUCT - 18" DUCT - 22" DOUBLE "V" CLAMP - 2R INSULATION & SINGLE "V" CLAMP INCLUDED - REDUCED CLEARANCE. TOTAL WEIGHT 468.44 HORIZONTAL VERTICAL TYPE DUCT DIAMETER SUPPORT SPACING (FT) 2R (18")8"7' 10"7' 12"7' 14"7' 16"7' 18"5' 20"5' 22"5' DOUBLE WALL FACTORY BUILT DUCTWORK - ALL DUCTWORK IS REQUIRED TO BE INSTALLED WITH THE MAXIMUM SUPPORT SPACING LISTED BELOW. - FOR A COMPLETE LIST OF APPROVED SUPPORT METHODS, SEE THE ENTIRE INSTALLATION AND OPERATION MANUAL - DUCTWORK SHALL SLOPE NOT LESS THAN 1/16" PER LINEAR FOOT TOWARDS THE HOOD OR AN APPROVED GREASE COLLECTION RESERVOIR. - WHERE HORIZONTAL DUCTS EXCEED 75 FEET IN LENGTH, THE SLOPE SHALL NOT BE LESS THAN 3/16" PER LINEAR FOOT. 24"5' WALL SUPPORT (FT) CURB SUPPORT (FT) FLOOR SUPPORT (FT) 18'24'24' 3R & 3Z (5"-24")10'24'24' 3Z (26" -36")10'20'20' 26"5' 28"5' 30"5' 32"5' 34"5' 36"5' 2R & 2R HT (5"-16")20'24'24'7"7' 6"7' 5"7' DO NOT LEAK TEST USING SMOKE BOMBS CONTAINING CHLORINES/CHLORIDES. CONSULT WITH CAPTIVEAIRE FOR PROPER LEAK TESTING METHODS. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233P1 P2 P4 P5 P6 P7 P8 P9 25.45" 67.5"MAX 50.5" 30"MIN 110"MAX 98" 72.5"MIN 18" 22" 28.50" 48"MAX 36" 21.5"MIN DUCTWORK #1 SIDE VIEW P1 P2 P4 P5P6 P7 P8 P9 DUCTWORK #1 SE VIEW ESTIMATED DUCT RUN SHOWN. FIELD CONFIRM ALL ELEVATIONS AND OFFSETS REQUIRED. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-16 THE BUILDING IS CONSTRUCTED WITH LOAD-BEARING CMU EXTERIOR WALLS AND WOOD ROOF TRUSSES. OCCUPANCY CALCULATIONSPER NFPA LIFE SAFETY 101THE PROJECT IS A TENANT BUILD-OUT FOR ISLAND DONUTS.STANDING SPACE = 5 SQ. FT. PER PERSONNET. = 61SF / 5 SF= 13 PEOPLEKITCHEN = 200 SQ. FT. (FBC) 100 SQ. FT. (NFPA) PER PERSONNET. = 581 SF / 100 = 6 PEOPLE; 581 SF / 200 = 3 PEOPLE13 PEOPLETOTALSCALCULATIONS 25 PEOPLE06 PEOPLE1234SEATING ACTUAL = 25 PEOPLE01 PERSONWALK-IN + STORAGE = 300 SQ. FT. PER PERSONNET. = 92 SF / 300 SF= 1 PERSON13 PEOPLETOTALS 25 PEOPLE03 PEOPLE01 PERSON TOTAL OCCUPANT LOAD: 45 PEOPLEINDOOR SEATING = 15 SQ. FT. PER PERSONNET. = 595 SF / 15 SF= 40 PEOPLEFFPC/NFPA 101FBC 42 PEOPLE4 PERSON TABLES: 4 x 4 = 16 SEATSBAR STOOLS: 9 x 1 = 09 SEATSTENANT AREA:2,032 SF THE BUILDING IS NOT EQUIPPED WITH AN AUTOMATIC SPRINKLER SYSTEM.FLORIDA BUILDING CODE 7th EDITION (2020)FLORIDA BUILDING CODE - ACCESSIBILITY 7th EDITION (2020) FLORIDA FIRE PREVENTION CODE 7th EDITION (2020) (ENCOMPASSING THE 2018 EDITIONS OF NFPA 1 & NFPA 101)CONSTRUCTION: FBC SECTION 602.2 - TYPE IIB, UNPROTECTED, NON-SPRINKLEREDALLOWABLE HEIGHTS AND BUILDING AREAS: TABLE 504 - TYPE IIBALLOWABLE AREA (NS) - 23,000 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 3BUSINESS (B):OCCUPANCY CLASSIFICATION (FBC): BUSINESS (B) FBC 304.1; NFPA 3.3.40, 3.3.196.3 AND CHAPTER 38(NEW BUSINESS OCCUPANCIES). SECTION 302.1.1 SMALL BUILDINGS AND TENANT SPACES: A BUILDING OR TENANT SPACE USED FOR ASSEMBLY PURPOSES WITH AN OCCUPANT LOAD OF LESS THAN 50 PERSONS SHALL BE CLASSIFIED AS A GROUP B OCCUPANCY. OCCUPANCY CLASSIFICATION (FFPC): MERCANTILE (M) FBC 309.1; NFPA 3.3.182, 3.3.196.9 AND CHAPTER 36(NEW MERCANTILE OCCUPANCIES). ALLOWABLE AREA (NS) - 12500 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 2MERCANTILE(M): A.3.3.196.9 MERCANTILE OCCUPANCY: OCCUPANCIES INCLUDE THE FOLLOWING: RESTAURANTS WITH FEWER THAN 50 PERSONS.TYPE IIB - TABLE FBC 601STRUCTURAL FRAMEINCLUDING COLUMNS, GIRDERS, TRUSSESBEARING WALLSEXTERIORINTERIORNONBEARING WALLS AND PARTITIONSEXTERIORNONBEARING WALLS AND PARTITIONSINTERIORFLOOR CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSROOF CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSBUILDING ELEMENT0TYPE IIB00000TYPE IIB - TABLE FBC 602OCCUPANT LOAD:MINIMUM OCCUPANT LOAD - NFPA TABLE 7.3.1.2 & 12.1.7:OFFICE: 150 GROSS SF PER PERSONCOMMERCIAL KITCHEN (PREP AREA & BAR): 100 GROSS SF PER PERSON (FFPC) OR 200 GROSS SF PER PERSON (FBC)STORAGE, STOCK, WALK-IN COOLER: 300 GROSS SF PER PERSONQUEUING AREA: 5 NET SF PER PERSONUNCONCENTRATED (TABLES AND CHAIRS) = 15 SQ. FT. PER PERSON < 5FIRE SEPARATION DISTANCE > 5< 10> 10< 30> 30(FT)TYPE OF CONSTRUCTIONOTHERSOTHERSIIBALLGROUP B1100GROUP M2100CLASS A INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 0-25; SMOKE DEVELOPED 0-450CLASS B INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 26-75; SMOKE DEVELOPED 0-450CLASS C INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 76-200; SMOKE DEVELOPED 0-450MEANS OF EGRESS:OCCUPANCYMINIMUM AS REQUIRED BY FBC TABLE 803.11 (NON-SPRINKLERED):VERTICAL EXITSEXIT ACCESS CORRIDORSROOMS & ENCLOSED SPACESINTERIOR FINISHES:AS REQUIRED BY FFPC TABLE A.10.2.2:OCCUPANCYEXIT ACCESSOTHER SPACESMERCANTILEABCMERCANTILEA OR BA OR BA OR BVERTICAL EXITSEGRESS WIDTH PER PERSON SERVED:OTHER EGRESS COMPONENTS (CORRIDORS, RAMPS, ETC.) = 0.20" (FBC 10005.3.2)MINIMUM CLEAR WIDTH OPENING OF EXIT DOORS: 32" (32"/0.2" PER PERSON = 160 PERSONS)DOORS SHALL SWING IN THE DIRECTION OF EGRESS EXCEPT WHEN SERVING AN MINIMUM CORRIDOR AISLE WIDTH: 44" OCCUPANT LOAD OF LESS THAN 50 (FBC 1010.1.2.1)MAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): MERCANTILE - 200 FT FBC TABLES 1017.2 & 1020.4, & TABLE 1020.2:MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)MEANS OF EGRESS:NFPA 101 - 150 FT (MERCANTILE FFPC A.7.6)NFPA 101 - 20 FT (MERCANTILE FFPC A.7.6)MAXIMUM TRAVEL DISTANCE, DEAD END LENGTH, EXIT AND MEANS OF EGRESS WIDTH: COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (MERCANTILE) FFPC A.7.6CORRIDOR FIRE-RESISTANCE RATING (FBC TABLE 1020.1): GREATER THAN 30 OCCUPANTS w/o SPRINKLER SYSTEM - 10 (MERCANTILE - FFPC 36.3.6.1 EXCEPTION 1)(0.20" x 42 OCCUPANTS = 8.4" STAIR WIDTH REQUIRED)I OR IINABUSINESSABCBUSINESSA OR BA OR BA, B OR CMAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): BUSINESS - 200 FT NFPA 101 - 200 FT (BUSINESS FFPC A.7.6)MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)NFPA 101 - 20 FT (BUSINESS FFPC A.7.6)COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (BUSINESS) FFPC A.7.61 (BUSINESS - FFPC 38.3.6.1)EXISTING 1 HR FIRE RATED DEMISING WALLPERSONS (P) DISCHARGING AT EXIT OR EXIT ACCESS,AND EGRESS CLEAR WIDTH (AT DOORS).INDICATES EXIT OR EXIT ACCESS, NUMBER OFSAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM TRAVEL DISTANCE TO AN EXTINGUISHER = 75 FTMAXIMUM FLOOR AREA PER 2A UNIT = 3,000 SFMAXIMUM FLOOR AREA PER EXTINGUISHER = 11,250 SFAND EGRESS CLEAR WIDTH (AT DOORS).SAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM FLOOR AREA PER UNIT OF A = 1,500 SFFECSERIES CABINETS. CLEAR BUBBLE, BLACK LETTERS PROVIDE FIRELOCATED IN 2 1/2" ROLLED EDGE, SEMI-RECESSED, CAMEOFEC- FIRE EXTINGUISHER & CABINET FIRE EXTINGUISHERSCLASS A FIRES (ORDINARY COMBUSTIBLE MATERIALSSUCH AS WOOD, CLOTH, PAPER RUBBER AND MANY PLASTICS)CLASS B FIRES (LIQUIDS, TARS, OILS, GASES)CLASS C FIRES (ELECTRICAL EQUIPMENT)FIRE EXTINGUISHER TYPE "A" (UL RATING 3A-40B:C) 5 LB MULTIPURPOSE DRY CHEMICALEQUAL TO BADGER MODEL #5MB-6H (A KIDDE COMPANY)FIRE EXTINGUISHER TYPE "B" (UL RATING 2-A:K) 6 LITER (1.56 GAL) EXTINGUISHER FOR CLASS K FIRESEQUAL TO KITCHEN ONE MODEL #KS-6000 BY PYRO-CHEMCLASS K FIRES (COOKING MEDIA - VEGETABLE OR ANIMAL OIL AND FATS)FIRE EXTINGUISHERS SHALL BE CERTIFIED BY A LICENSE FIRE PROTECTION COMPANYWATER CLOSETS BUSINESS (B)21 MALES21 FEMALESTOTAL OCCUPANT LOAD BUSINESS - 42LAVATORIES1 LAV PER 100DRINKINGFOUNTAINS2 REQUIRED WATERCLOSET2 REQUIRED LAVATORIES1 WC PER 25 MALE/FEMALE FOR FIRST 50 AND 1 PER 80 FOR REMAINDER EXCEEDING 801 SERVICE SINKSERVICE SINK1 LAV PER 40 MALE/FEMALE FOR FIRST 80 AND 1 PER 50 FOR REMAINDER EXCEEDING 50PLUMBING FIXTURE COUNT PER TABLE 403.1 FLORIDA PLUMBING CODESEPARATE FACILITIES (FLORIDA PLUMBING CODE SECTION 403.2):EXCEPTION 04: SEPARATE FACILITIES SHALL NOT BE REQUIRED INBUSINESS OCCUPANCIES IN WHICH THE MAXIMUM OCCUPANT LOAD IS 25 OR FEWER.3"-4"31 2"RECESSED REMOTE FIRE PROTECTIONPULL STATION DETAILBOX AND CONDUIT INSTALLED AND SECURED BY ELECTRICAL CONTRACTORFIRE SYSTEM INSTALLATION SHALL BE BY AUTHORIZED ANSUL DISTRIBUTORREMOTE FIRE SYSTEM PULLDETAIL RFP-1PULL08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CODE DATA G-1ARCHITECTURALMECHANICALPLUMBINGPLUMBING LEGEND AND PROJECT NOTESP-1ELECTRICALPLUMBING SCHEDULESP-2PLUMBING PLANSP-3DOMESTIC WATER PLANP-4PLUMBING GAS PLAN AND GAS RISERP-5M-1 MECHANICAL NOTES, LEGEND AND ABBREVIATIONSM-2 MECHANICAL SCHEDULESM-3 MECHANICAL PLANM-4 MECHANICAL DETAILSG-1 CODE DATAG-2 LIFE SAFETY PLANA-1 EXISTING FLOOR PLANA-1.1 DEMOLITION FLOOR PLANA-2 FLOOR PLAN & GENERAL NOTESA-2.1 WALL FINISH PLANA-2.2 FLOOR FINISH PLANA-2.3 ROOF PLANA-2.4 EQUIPMENT SCHEDULEA-3 EXISTING REFLECTED CEILING PLANA-3.1 REFLECTED CEILING PLANA-4 ENLARGED TOILET ROOM PLANA-4.1 DOOR & HARDWARE SCHEDULEA-5 INTERIOR ELEVATIONSA-5.1 INTERIOR ELEVATIONSA-5.2 INTERIOR ELEVATIONSA-6 ACCESSIBILITY GUIDELINESPLUMBING DETAILSP-6SANITARY RISERSP-7E-1 POWER PLANE-2 LIGHTING PLANSCALE: N.T.SSITE MAPPROJECT SITEPLUMBING SCHEDULESP-2.1PLUMBING DETAILSP-6.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"17" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK160P32"NOTE A160P32"NOTE A160P32"NOTE A160P32"NOTE AEXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 EXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 29'26'25'33'FEFEFENOTE A:EXIT DOOR TACTILESIGNAGE READING:EXITSIGNAGE SHALLCOMPLY w/ANSI/CABOA117.1; MOUNT 60" AFFTO CENTERLINE OF SIGNDOORS NOT REQUIRING SPECIAL TOOLSLOCKS ON EXIT DOORS SHALL NOT REQUIRETHE USE OF A KEY, A TOOLOR SPECIAL KNOWLEDGE OR EFFORTFOR OPERATION FOR OPERATION FROMEGRESS SIDE UNLESS THEY MEET THEREQUIREMENTS OF NFPA 101 7.2.1.5.ON THE TENANT'S SUITE. LETTERS PROVIDE MIN 6" HIGH LETTERSTHE STREET THEREFORE THE ADDRESS NUMBER MUST BE VISIBLE & LEGIBLE FROM MAY NEED TO BE LARGER THAN THE MINIMUMOF 6" - COORD w/ FIRE MARSHAL315 SF PERPERSON25 PEOPLE595 SF5 SF PER PERSON13 PEOPLE61 SF12581 SF200 SF PERPERSON (FBC)3 PEOPLE100 SF PERPERSON (FFPC)6 PEOPLE4300 SF PERPERSON1 PEOPLE92 SFE1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"16" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK234408-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 LIFE SAFETY PLANSCALE:1/4":1'0"LIFE SAFETY PLANG-2SCALE:1/4":1'0"OCCUPANCY CALCULATIONS K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHU08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING FLOOR PLANA-1 K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHUREMOVE EXISTINGWALLSREMOVE EXISTINGOVERHEADREMOVE EXISTINGWALLSREMOVE EXISTINGWALLSREMOVEEXIST.PLUMBINGFIXT.REMOVEEXIST. DOOR& MILLWORKREMOVE EXISTINGWALLS07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DEMOLITION PLANSCALE:1/4":1'0"DEMOLITION PLANA-1.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER101101A103107108109101B10501*01010101020202010101*01*33214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242550101011828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.17" DEEP COUNTER10. DIMENSIONS NOTED AS "CLEAR" ARE FROM FACE OF GYPSUM WALLBOARD TO GYPSUM WALLBOARD.GENERAL NOTES3. THIS BUILDING WILL BE A NONSMOKING FACILITY.4. ALL WORK SHALL BE IN COMPLIANCE WITH THE BUILDING CODES, RECOGNIZED INDUSTRY STANDARDS, CRAFTSMANSHIP STANDARDSIN THE AREA, AND ALL MANUFACTURER'S RECOMMENDATIONS.5. THERE SHALL BE A FLOOR OR LANDING ON EACH SIDE OF A DOOR. SUCH FLOOR OR LANDING SHALL BE AT THE SAME ELEVATION ON EACH SIDE OF THE DOOR. LANDINGS SHALL BE LEVEL EXCEPT FOR EXTERIOR LANDINGS WHICH ARE PERMITTED TO HAVE A SLOPE NOT TO EXCEED 0.25 UNIT 6. FIELD VERIFY ALL DIMENSIONS AND EXISTING CONDITIONS PRIOR TO CONSTRUCTION. REPORT ANY AND ALL DISCREPANCIES TO THE ARCHITECT/ENGINEER.8. CONTRACTOR SHALL PERMANENTLY IDENTIFY ALL FIRE-RESISTANT-RATED WALLS (AND CORRESPONDING FIRE-RESISTANT RATINGS)INCLUDING FIRE BARRIER WALLS, SMOKE BARRIER WALLS, FIRE PARTITIONS, FIRE WALLS, AND SHAFT ENCLOSURES EITHER BYINSTALLING SIGNS OR BY STENCILING IN CONCEALED SPACES THE FOLLOWING: ( ) HOUR FIRE AND SMOKE RATED BARRIER -PROTECT ALL OPENINGS. IDENTIFICATION SHALL BE SPACED NO MORE THAN TWELVE (12) FEET ON CENTER WITH A MINIMUMLETTER SIZE OF TWO (2) INCHES IN HEIGHT ON A CONTRASTING BACKGROUND9. DO NOT SCALE DRAFTING, REPORT ERRORS IN DIMENSIONING TO ARCHITECT BEFORE PROCEEDING WITH WORK.2. SELF CLOSING DEVICES SHALL BE PROVIDED ON DOORS IN A MEANS OF EGRESS AND SHALL MEET THE REQUIREMENTS OF THENFPA LIFE SAFETY CODE 101 (2018) CHAPTER 7.2.1.8 AND THE FLORIDA FIRE PREVENTION CODE 7th EDITION.1. SWING & FORCED OPEN DOORS SHALL MEET THE REQUIREMENTS OF NFPA LIFE SAFETY CODE AS FOUND IN THE FLORIDA FIRE PREVENTION CODE 6th EDITION CHAPTER 7.2.1.4 AND THE FLORIDA BUILDING CODE 7th EDITION (2020) 1008.1.2.VERTICAL IN 12 UNITS HORIZONTAL (2% SLOPE). FBC 1010.1.57. THE GENERAL CONTRACTOR SHALL PROVIDE FLORIDA PRODUCT APPROVAL NOTICES ON ALL REQUIRED COMPONENTS AND CLADDING.11. PLANS FOR FIRE-PROTECTION SPRINKLER SYSTEM (NOT PROVIDED BY DSAE), INCLUDING SUPPORT DETAILS, SHALL BEREVIEWED AND APPROVED BY THE LOCAL AUTHORITY PRIOR TO INSTALLATION FOR COMPLIANCE WITH THE FLORIDA BUILDING CODE7th EDITION (2020) AND NFPA 13 (LATEST EDITION).1. THE CONTRACTOR SHALL VISIT, BEFORE SUBMITTING PRICES. GENERAL NOTES - FINISHES2. ALL INTERIOR DOOR FRAMES SHALL BE PAINTED.3. ALL INTERIOR PARTITIONS SHALL RECEIVE TWO COATS OF SHERWIN WILLIAMSSEMI-GLOSS PAINT OVER ONE COAT OF PRIMER UNLESS OTHERWISENOTED. 4. ALL HORIZONTAL GYPSUM BOARD SURFACES SHALL BE PRIMED WITHFLAT WHITE FINISH, UNLESS OTHERWISE INDICATED.5. FLOOR TRANSITIONS SHALL OCCUR AT THE CENTERLINE OF DOORS. SUBMIT SAMPLES FOR OWNER'S SELECTION PRIOR TO INSTALLATION.6. CENTER FLOOR TILES IN ROOM, UNLESS OTHERWISE NOTED.7. ALL LEFT OVER PAINT SHALL BE CLEARLY LABELED AND APPROPRIATELYPACKAGED. CONTRACTOR SHALL DELIVER ALL LEFTOVER PAINT AND FINISHMATERIALS TO TENANT FOR STORAGE.8. ALL INTERIOR FINISHES TO BE THE MINIMUM CLASSIFICATION AS LISTED ON THECODE DATA SHEET.NOTES:1. MEASURING 8" HORIZONTALLY AND 8 INCHES VERTICALLY, OF A BRIGHT RED REFLECTIVE COLOR.2. THE SYMBOL SHALL BE PLACED WITHIN 24" TO THE LEFT OF THE MAIN ENTRY DOOR .3. BE PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE ON ACONTRASTING BACKGROUND.4. BE MOUNTED ON A CONTRASTING BASE MATERIAL WHICH IS THEN PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE.5.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR FINISHED FLOOR TO THE BOTTOM OF THE SYMBOL SHALL NOT BE LESS THEN 4FEET (48").6.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR THE FINISHEDFLOOR TO THE TOP OF THE SYMBOL SHALL BE NOT MORE THAN 6' (72 IN.)8"8"07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR PLANSCALE:1/4":1'0"FLOOR PLANA-2NOTESINSULATIONTYPEWALL TYPE SCHEDULEDESCRIPTION2. EXPOSED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 25 ANDA SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.3. CONCEALED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 75 AND A SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.NOTES:5. PROVIDE WOOD BLOCKING AS REQUIRED TO SUPPORT TOILET ROOM FIXTURES, ACCESSORIES, SHELVES & CABINETS, FIRE EXTINGUISHERS, ETC. WOOD BLOCKING IN FIRE-RATED WALLS SHALL BE FIRE-RATED. 6. PROVIDE R-11 SOUND ATTENUATION BATT AROUND THE TOILET ROOMS.1. PROVIDE FIREBLOCKING AND DRAFTSTOPPING IN PARTITIONS PER FBC 717. PROVIDE FIREBLOCKING IN CONCEALED WALL SPACES INCLUDING VERTICALLY AT THE CEILING AND FLOOR LEVELS AND HORIZONTALLY AT INTERVALS NOT EXCEEDING 10' (FBC 717.2.2). SEE FBC 717.2.1 FOR FIREBLOCKING MATERIAL OPTIONS.COMBUSTIBLE WOOD BLOCKING IN NON FIRE-RATED WALLS IS PERMITTED 4. PROVIDE WATER RESISTANT GYPSUM BOARD AROUND PLUMBING FIXTURES AND WALLS TO RECEIVE CERAMIC TILEEQUAL TO USG'S FIBEROCK'S BRAND AQUA-TOUGH INTERIOR PANELS. GYPSUM WALLBOARD PRODUCTS MUST BE RATED FOR WET LOCATIONS IN ACCORDANCE WITH THE TILE COUNCIL OF NORTH AMERICA (TCNA) HANDBOOK. GREEN BOARD IS NOTAPPROVED FOR TOILET ROOM LOCATIONS.133 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON EACH SIDE; EXTEND WALL 6" ABOVE THER-11NEW 3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE; EXTEND WALL 6" ABOVE THER-132NEW 6", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDR-133/8" AIR GAP FROM EXISTING CMU WALLADJACENT CEILINGADJACENT CEILING1/2" AIR GAP FROM EXISTING CMU WALLON ROOM SIDE; EXTEND WALL 6" ABOVE THEADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/2401*3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE AND 1/2" PLYWOOD ON KITCHEN SIDER-11EXTEND WALL 6" ABOVE THE ADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240 ROOM FINISH SCHEDULESEATING AREAFLOORBASEWALLSCEILINGCEILINGHEIGHTREMARKS101RSRESILIENT WALL BASEVCTVINYL COMPOSITION TILEACTACOUSTICAL CEILING TILES/SSTAINLESS STEEL PANELS====PTPAINT=FRPFIBERGLASS REINFORCED PANEL=CTCERAMIC TILE=SCSTAINED CONCRETE=EPEPOXY PAINT=QTQUARRY TILE=107WOMEN'S TOILET ROOMROOM NAMEPROVIDE MOISTURE RESISTANT GYPSUM WALLBOARD (ASTM C630/630M) IN WASH DOWN AND WET AREAS; COORD w/OWNER'S REPACOUSTICAL CEILINGS SHALL COMPLY w/ THE FOLLOWING: ASTM C635, ASTM C636, ASTM C665, ASTM E580, ASTM C1284 AND CEILINGS AND GYPSUM BOARD:PROVIDE TILE BACKER BOARD (DEN-SHIELD OR APPROVED EQUAL) ON WALLS TO RECEIVE CERAMIC TILE (ASTM C1178)PROVIDE FIRE RATED GYPSUM BOARD TYPE "X" 5/8" THICK ON FIRE RATED PARTITION (ASTM C36) INSTALLED PER UL ASSEMBLY REQUIREMENTSACOUSTICAL CEILING TILES:PROVIDE ACOUSTIC INSULATION (ASTM C665) AROUND ALL TOILET AND BATHROOMS AND AS NOTED ON THE WALL TYPE SCHEDULE. INSULATION INSULATION:SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED R-11 MIN.PROVIDE BATT INSULATION (ASTM C665) IN EXTERIOR WALLS AND SOFFIT AREAS WITH R-VALUES AS NOTED ON PLANS AND SECTIONS. BATT INSULATION SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED.INSULATION SHALL HAVE FLAME/SMOKE PROPERTIES 75/450 IN ACCORDANCE WITH ASTM E84STUDS AND TRACKS (ASTM C645, GA-216, GA-600) SHALL BE GALVANIZED SHEET STEEL, 0.0188" THICK (25 GA), 0.284 (22 GA), 0.0359 (20 GA); FRAMING MATERIALS:ANCHOR TO SUBSTRATE WITH TIE WIRES, NAILS, SCREWS, AND OTHER METAL SUPPORTS, OF TYPE AND SIZE TO SUIT APPLICATION TO RIGIDLY METAL STUD INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: MAXIMUM DEFLECTION OF INTERIOR NON-LOAD BEARING PARTITIONS SHALL BE L/240 AT 5 PSF. PROVIDE LATERAL REINFORCING CEILING FRAMING INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: LEVEL CEILING TO A TOLERANCE OF L/600. LATERALLY BRACE ENTIRE SUSPENSION SYSTEM.GYPSUM BOARD INSTALLATION: INSTALLPER GA-216 & GA-600. ERECT EXTERIOR GYPSUM SHEATHING IN ACCORDANCE WITH ASTM C1280.PROVIDE A GYPSUM BOARD ACCESSORIES AS REQUIRED : ACOUSTIC SEALANT, CORNER BEADS, EDGE TRIM (GA-216), JOINT MATERIALS (ASTM C475 & GA-216) - REINFORCING TAPE, JOINT COMPOUND, ADHESIVE & WATER.GYPSUM BOARD FINISHES:LEVEL 1 - ABOVE FINISHED CEILINGS CONCEALED FROM VIEWLEVEL 2 - WALLS BEHIND CABINETRYLEVEL 3 - WALLS EXPOSED TO VIEWLEVEL 4 - CEILING EXPOSED TO VIEWLEVEL 5 - SPECIAL WALLS TO RECEIVE WRITING SURFACES, PAINTED MURALS, OR PROJECTION SCREENS.INTERIOR SYSTEMS CONSTRUCTION ASSOCIATION.INSTALLATION: INSTALL LAY-IN CEILING IN ACCORDANCE WITH ASTM C636 AND ASTM E580. INSTALL SYSTEM CAPABLE OF SUPPORTING IMPOSED LOADS TO DEFLECTION OF L/360 MAXIMUMACCESSORIES: PROVIDE ALL NECESSARY ACCESSORIES; GALVANIZED SUPPORT HANGERS AND CHANNELS, PERIMETER MOLDINGS (SAME MATERIAL AND FINISH AS THE GRID - L-SHAPED MOLDING FOR MOUNTING AT THE SAME ELEVATION AS FACE OF GRID)TOUCH UP PAINT AS REQUIRED TO MATCH GRID.INSTALL TILE PER THE TCA (TILE COUNCIL OF AMERICA) HANDBOOK FOR TILE INSTALLATION.CERAMIC AND QUARRY TILESECURE MATERIALS IN PLACE.AS REQUIREDNOTE:ALL FINISHES AND COLORS SHALL BE APPROVED BY OWNER PRIOR TO ORDERINGFINISHES:C-SHAPE, WITH KNURLED FACES.VINYL COMPOSITION TILE (VCT):VCT EQUAL TO ARMSTRONG STANDARD EXCELON SERIES; 12" x 12" x 1/8"1.1PERFORMANCE REQUIREMENTSA.Conform to applicable code for fire performance ratings as follows:1.Flooring, critical radiant flux (CRF): Minimum 0.45 watt per square centimeter, per ASTM E 648.2.Flooring, smoke developed: Maximum 450, per ASTM E662.3.Class 2 finish per ASTM F1066ORDER COUNTER102OFFICE103CONDIMENT AREA104KITCHEN/PREP/DW105WALK-IN COOLER106MEN'S TOILET ROOM108JAN CLOSET1092x2 SUSPENDED VINYLACOUSTICAL TILE & GRIDVBVINYL BASE=ALALUMINUM= (COORDINATE ANY LOCATIONS OF LEVEL 5 FINISH WALLS w/OWNER AND ARCHITECT PRIOR TO BIDDING)SCCTSCSCSCQTQTCTSCHEXAGON FLOOR TILESHEXAGON FLOOR TILESFRP/SS/PWADTPEP/CTEP/CTPWPLYWOOD=QTQT--------------VINYL ACTACTACTACTACTACTACTACT10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"SHIP LAP WALL SIDINGPTPTPTPTPT8'-0"ADTP4" INSULATED CEILING PANELSHIP LAP WALL SIDINGSHIP LAP WALL SIDINGWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105SUBWAY TILE (CT)PLYWOOD (PW)WALL FINISH LEGENDPAINT (PT)FIBERGLASSREINFORCEDPANEL (FRP)STAINLESS STEEL(SS)PLYWOOD(PW)BLOCKINGW/FRP WALLFINISHPAINT,TYP.STAINLESSSTEEL, TYP.SUBWAYTILE(CT)SUBWAYTILE(CT)FIBERGLASSREINFORCEDPANEL, TYP.PAINT,TYP.PLYWOOD(PW) BLOCKINGw/FRP WALLFINISHPLYWOOD(PW)BLOCKINGw/FRP WALLFINISHSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDING ONTOP AND BOTTOM OFWINDOWS, TYP.STAINLESSSTEEL, TYP.FRPSTAINLESSSTEELWRAPPEDOPENINGFRP WRAPPEDOPENING07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 WALL FINISH PLAN AND ROOM FINISH SCHEDULE A-2.1SCALE:1/4":1'0"WALL FINISH PLAN WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105QUARRY TILE(QT)STAINED CONCRETE(SC)FLOOR FINISH LEGENDHEXAGONALFLOOR TILE(CT)07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR FINISH PLAN A-2.2SCALE:1/4":1'0"FLOOR FINISH PLAN EXISTING TENANTSEPARATION FIRE WALLKITCHEN HOODBELOWEXISTING TENANTSEPARATION FIRE WALLCU-2CU-1PROVIDE LANDLORD APPROVEDCONDENSATE STANDS FORWALK-IN-COOLER & FREEZERCONDENSERSPROVIDE PERMANENT FALLARREST/RESTRAINT ANCHORAGECONNECTOR DEVICESCOMPLYING w/ANSI/ASSE Z 359PER FMC 304.11 EXCEPTION07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ROOF PLAN A-2.3SCALE:1/4":1'0"ROOF PLAN E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER3214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242551828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.17" DEEP COUNTER07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULESCALE:1/4":1'0"EQUIPMENT PLANA-2.4 07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULE A-2.5 WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104NOTE A:EXHAUST HOOD SYSTEMBELOW; FIT ACOUSTICALCEILING AROUND EXHAUSTHOOD; PROVIDE STAINLESSSTEEL CLOSURE PANELBETWEEN EXHAUST HOOD &ACOUSTICAL CEILINGNOTE AFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFF FFFF FFFF FFFF GYP. BD. & METAL STUDBULKHEAD @ 9'-6"BOTTOM OFSOFFIT @9'-7"FFFFFFFF 2x2 SUSPENDED ACOUSTICAL VINYL FACEDTILE & GRIDRECESSED CEILINGFIXTUREEMERGENCY EXIT LIGHTEXIT SIGN2 x 2 SUPPLY DIFFUSERGYPSUM WALLBOARD SOFFITCEILINGPENDANT FIXTURE2 x 4 LIGHT FIXTURE2 x 2 LIGHT FIXTUREEMERGENCYLIGHT2 x 2 RETURN AIREXHAUSTFANTRACK LIGHTINGw/PENDANTSWALLSCONCEFFFF FFFF EXH FANVINYL ACOUSTICAL CEILING TILE2 x 4 LIGHT FIXTURE w/BATTERY BACKUPFFFF 08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 REFLECTED CEILING PLANSCALE:1/4":1'0"REFLECTED CEILING PLANA-3.1 ATTIC ACCESSREMOVE EXISTING SOFFIT.BOTTOM OF SOFFIT @ 7'-10"REMOVE EXISTING DUCTREMOVE EXISTINGDUCTLESS HVAC UNITREMOVE EXISTING AIRHANDLER UNITREMOVE EXISTING LIGHTS,TYP.REMOVE EXISTING LIGHTS,TYP.REMOVE EXISTINGDIFFUSERS & DUCTS, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.EXISTING SLOPINGACOUSTICAL CEILING TILE &GRIDREMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.REMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.EXH FANACOUSTICAL CEILINGHEIGHT: 9'-10 58"GYP BOARD CEILINGHEIGHT ABOVE ACT: 11'-10 58"ACOUSTICAL CEILINGHEIGHT: 7'-4 18"ACOUSTICAL CEILINGHEIGHT: 9'-0"BOTTOM OF GYP BOARDCEILING 11'-9 78"REMOVE EXISTING EXITSIGNS, TYP.08-23-22ISLAND DONUTS TENANT BUILD-OUTSHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING REFLECTED CEILING PLANA-3 A-41243MEN'STOILET ROOM108A-456WOMEN'STOILET ROOM10708-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ETR PLAN & ELEVATIONS SCALE:1/2":1'0"ENLARGED TOILET ROOM PLANA-4SCALE:1/2":1'0"ELEVATION 01SCALE:1/2":1'0"ELEVATION 02SCALE:1/2":1'0"ELEVATION 03SCALE:1/2":1'0"ELEVATION 04SCALE:1/2":1'0"ELEVATION 05SCALE:1/2":1'0"ELEVATION 06TOILET ACCESSORY LEGENDNOTES1. HANDICAPPED ACCESS MOUNTINGDIMENSIONS ARE VERY CRITICALACCESSORIES TO BE IN ACCORDANCEMOUNTING LOCATION OF TOILETAND HAVE NO MINUS TOLERANCES.WITH A.D.A. TITLE III & FLORIDABUILDING CODE 7th EDITION (2020) -ACCESSIBILITY.WHERE THE TOILET IS FOR INDIVIDUAL USE AND CLEAR FLOOR SPACE COMPLYING WITHFBC-ACCESS 305.3 (A 30"x48" SPACE) IS PROVIDED WITHIN THE ROOM BEYOND THEARC OF THE DOOR SWING, DOORS SHALL BE PERMITTED TO SWING INTO THE CLEARFLOOR SPACE OR CLEARANCE REQUIRED FOR ANY FIXTURE (FBC-ACCESS 603.2.3 EXCEPTION 2)WHERE THE SPACE BENEATH AN ELEMENT IS INCLUDED AS PART OF THE CLEARFLOOR OR GROUND SPACE, THE SPACE SHALL COMPLY WITH FBC-ACCESSIBILITY306 FOR KNEE & TOE CLEARANCETHE SPACE BENEATH THE SINK COMPLIES WITH THIS REQUIREMENT FACE OF FINISH. FINISH THICKNESS 2. ALL DIMENSIONS SHOWN ARE FROM MUST BE ADDED TO ANY ROUGH IN DIMENSIONS.SURFACE MTD. SOAP DISPENSERDOUBLE TOILET PAPER HOLDERTOWEL DISPENSERSURFACE MTD. PAPERHANDICAPPED GRAB BAR24 x 36 MIRRORBASIS OF DESIGNCSI BATHWARE BAR-SB36-TW-125-MBBASIS OF DESIGNSUNERA BLACK PAPER TOWEL DISPENSERBASIS OF DESIGNNXHOME RECTANGULARw/ROUNDED CORNERSNotes: (Typical for All Signs)1.6" MIN HIGH BORDER DIMENSION ~ TACTILE MALE/FEMALE FIGURES.2.THE USE OF THE MALE/FEMALE TACTILE CARICATURES AREREQUIRED.3.LETTERS, NUMERALS, BRAILLE LETTERS AND PICTORIAL SYMBOLSSHALL BE RAISED 132" FROM THE BACKGROUND AND SHALL BE 58"MINIMUM TO 2" MAXIMUM IN HEIGHT.4.BRAILLE LETTERS SHALL BE RAISED IN GRADE 2 BRAILLE.5.CHARACTER PROPORTION AND HEIGHT TO w/ ANSI A117.1 SECTION703.6.COLOR CONTRAST SHALL COMPLY W/ ANSI A117.1 SECTION 703.3.12.7.THE SIGN HORIZONTAL CENTERLINE SHALL BE @ 60" AFF.8.THE SIGN LOCATION SHALL BE LOCATED ON THE WALL ORPARTITION TO THE STRIKE JAMB/LATCH SIDE OF THE DOOR.9.ALL SPECIFICATIONS FOR SIGNAGE MUST COMPLY W/ ICCA117.1-2009 CHAPTER 7, COMMUNICATION ELEMENTS ANDFEATURES.WOMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANTWOMEN'S RESTROOM SIGNS WITH TACTILE TEXT AND GRADE 2 BRAILLEWomens Restroom Braille ADA Signs - 6" x 8"ADA-1020; Color - White on BlueMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANT MEN'SRESTROOM SIGN WITH TACTILE TEXT AND BRAILLEMens Restroom Braille ADA Signs - 6" x 8"ADA-1021; Color - White on BlueBASIS OF DESIGNBGL TOILET PAPER HOLDER - BLACK STAINLESS BASIS OF DESIGNWEWBABY 27ozMATTE BLACK3. ALL TOILET ACCESSORIES SHALL BE(WELDED FRAME)STRAIGHT GRAB BAR, 36", MATTE BLACKCSI BATHWARE BAR-SB48-TW-125-MB STRAIGHT GRAB BAR, 48", MATTE BLACKSTEEL FINISH TOILET PAPER ROLL HOLDER WITH SHELF WALL MOUNTED FOR BATHROOM(BLACK, DOUBLE HEAD)400 C-FOLD / 525 MULTI-FOLD PAPER TOWEL *DIAPER CHANGING STATION MODEL - Koala Kare KB200-SS Horizontal Wall MountedBaby Changing Station / Table GREY 01 color TO OPERATE. LEVER-OPERATED MECHANISMS ARE ACCEPTABLE DESIGNS.HAND AND DOES NOT REQUIRE TIGHT GRASPING, TIGHT PINCHING, OR TWISTING OF THE WRISTOPERATING LEVER ON DOOR SHALL HAVE A SHAPE THAT IS EASY TO GRASP WITH ONE2. PROVIDE LEVER TYPE COMMERCIAL (ANSI A156.2, 1996, SERIES 4000, GRADE 1 )1. ALL INTERIOR DOORS TO BE FLUSH SOLID CORE WOOD DOORS (BIRCH), GRADE DOOR HARDWARE (ANSI A117.1 COMPLIANT).DOORS AND HARDWARE3'-0" x 7'-0" x 1 3/4" - PAINT FINISH. FRAMES SHALL BE PAINTED4. COORDINATE ALL KEYING & LOCKSETS WITH TENANT.STEEL (WELDED OR KNOCK-DOWN) - COORDINATE w/TENANT.1 1/2 PR BUTT HINGES3 DOOR SILENCERSPRIVACY LOCKSETANSI F76 BED/BATH PRIVACY LOCK; PUSH-BUTTON LOCKING. TURNING INSIDE LEVER RELEASES PUSH-BUTTON. CAN OPEN FROM OUTSIDE VIA EMERGENCY RELEASE1 WALL STOP3. ALL EXTERIOR DOORS & DOORS SHALL BE GALVANIZED, INSULATED (R-7) METAL DOORS w/GALVANIZEDMETAL FRAMES.DOOR: Level 1 - Standard-duty, Model 1, nominal 20 gage/0.032 inch (0.8 mm) face sheets, 1 3/4", full flush designDOOR FRAMES: Level 1 for Door Models 1, nominal 18 gage/0.042 inch (1.0 mm) thick material, base metal thickness.HARDWARE GROUP 1HARDWARE GROUP 21 OFFICE LOCKSET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F82 KEY OPENS LOCK FROM OUTSIDE,PUSH-BUTTON LOCKING FROM INSIDE,LATCH TURNING INSIDE RETRACTS LOCK1 WALL STOPHARDWARE GROUP 31 PASSAGE SET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F75 BOTH LEVERS ALWAYS UNLOCKED1 WALL STOPWDWOOD=STLSTEEL=MTLMETAL=AL/GLALUMINUM/GLASS=DOOR SCHEDULEMARKLOCATIONTYPESIZEMATLGLAZINGLOUVERDOORSMATLTYPEGRPHDWLBL/RTGFRAMESREMARKS101ENTRANCEFG--ALAL/GL103OFFICEKITCHEN/DW105108MEN'S TOILET 3'0" x 7'0" x 1 3/4"--MTLWD3'0" x 7'0" x 1 3/4"--107WD1WOMEN'S TOILET1--MTLAL/GL----FFEXISTING DOOR & EXISTING HARDWARE TO REMAIN3'0" x 7'0" x 1 3/4"101AENTRANCEFG--ALAL/GL--AL/GL 3'0" x 7'0" x 1 3/4"EXISTING DOOR & EXISTING HARDWARE TO REMAINEXISTING DOOR & EXISTING HARDWARE TO REMAINF 3'0" x 7'0" x 1 3/4"--WD2MTL3'0" x 7'0" x 1 3/4"C----ALHM--EXISTING DOOR & EXISTING HARDWARE TO REMAIN109JAN CLOSETF 3'0" x 7'0" x 1 3/4"--WD3MTL101BEXIT3'0" x 7'0" x 1 3/4"C----ALHM--DOOR TYPES43" MAX 10" MIN STL. FRAMECAULK (BOTH SIDES -SEE SCHED. DOOR HGT./WIDTH STUD PARTITION2"G.W.B. & MTL.ALL AROUND)BACKBEND RETURNBARRIER-FREE CYLINDRICALLEVER SET DESIGNBARRIER-FREE CYLINDRICALLEVER SET DESIGN08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DOOR & HARDWARE SCHEDULE A-4.1 E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104101101A103107108109101B10501A-602A-603A-604A-607A-6.108A-6.105A-6.106A-6.110A-6.1RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETTHREE COMPARTMENT SINKPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKWALL-MOUNTEDHAND SINKDECK MOUNTWATERSTATIONGLAZERPROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLEDONUT FRYERDONUTDEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEEXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERCONDIMENT BAR17" DEEP COUNTER10'-0"SHIP LAP SIDINGHANDSINKWATERSTATIONBOXSTORAGE10'-0" 11'-93 4"COFFEESTATIONSSHIP LAPSIDINGGRAB-N-GO CASESELF-SERVE U/C CASEDONUTS DISPLAYRACK BY OWNERCOFFEE STATION10'-0"WRAP OPENINGw/STAINLESS STEELFACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLES IN WOODw/ PLASTER & LIME WASHSHIP LAPSIDING2'-10"1'-6"4'-0" 10'-0" 11'-93 4"FACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLESIN WOODw/ PLASTER & LIME WASHSHIP LAP SIDING08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONSSCALE:1/4":1'0"KEY PLANA-5SCALE:1/4":1'0"ELEVATION01SCALE:1/4":1'0"ELEVATION02SCALE:1/4":1'0"ELEVATION03SCALE:1/4":1'0"ELEVATION04 KLINGER'S SHEETRACK SPECSWOOD TOPBAKERS TABLE7'-0"2'-10"10"1'-6"10'-0" 6'-8"SHIP LAPSIDING11'-1014"STAINLESS STEELCLOSURE PANELFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRP2" STAINLESS STEELWRAP AROUNDOPENINGSTAINLESSSTEEL SHELFHANDSINKCONVEYORTOASTER60" REFRIGERATEDCHEF'S BASEGRIDDLEDOUGHNUTFRYER10'-0" 11'-93 4"KITCHEN/PREP/DW105OFFICE103STAINLESS STEELWALL PANELSSHIP LAPSIDINGPROVIDE 14 GA STEELBACKINGDONUT DEPOSITOR MOUNT ARM 38"AFF/7" OFF FRYER'S EDGE; COORDINSTALLATION W/TENANT;PROVIDE STEEL BLOCKINGDOUGHNUTFRYERHANDSINKTHREECOMPARTMENTSINK10'-0"11'-934"FIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPFRPSTAINLESS STEELWALL PANELSFIRE-RATEDTENANTSEPARATION WALLVINYL-FACED ACOUSTICALCEILING TILE & GRIDEXISTING GYP BOARDCEILING; PATCH & REPAIRSTAINLESS STEELCLOSURE PANELEXISTING WOODTRUSSES; FIELDVERIFY DESIGN &LOCATIONSTAINLESS STEELWORK TABLESHELVINGSHEETERPROFFER CABINET10'-0"S/S TABLEWOOD TOPBAKERS TABLESHIP LAPSIDINGVERTICAL ACOUSTICALCEILING FROM 8'-0" TO 12'-0"FOR STORAGE ABOVE W.I.C.AT PERIMETER OF W.I.C.WALK-IN-COOLERFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPDUCTWORK SEAMLESSLYWELDED LIQUIDTIGHT, TYP.HOOD DUCTS - DUCT WRAP EQUALTO 3M FIRE BARRIER DUCT WRAP 615+INSULATION - ZERO CLEARANCE PRODUCT18 GA, #4 WELDED STAINLESS STEELEXHAUST HOOD BY CAPTIVEAIRESTAINLESS STEEL PANEL (80" HIGH) SUPPLIED &INSTALLED BY EQPT. CONTRACTOR TOCOVER PORTIONS OF WALL UNDER THEEXHAUST HOOD.5/8" FIRE-RATED GYP BOARD (TYP X) (EXTENDSTHE FULL LENGTH AND HEIGHT OF THE WALLBEHIND THE HOOD, THE TYPE "x" BOARDS AREFASTENED WITH 2" #12 SCREWS DRYWALLSCREWS. SCREW PATTERN: FASTENERS @ 4"AROUND THE PERIMETER AND 6" IN THE FIELD1/2 " CEMENTITIOUS WALLBOARD (EXTENDS 24"BEYOND THE HOOD ON EACH SIDE). THECEMENT BOARDS ARE FASTENED WITH 2"DUROCK COURSE THREAD #10 SCREWS.SCREW PATTERN: FASTENERS @ 4" AROUNDTHE PERIMETER AND 6" IN THE FIELD20 ga STAINLESS STEEL PLATE (80" HIGH-EXTENDS 18" BEYOND THE HOOD ON EACHSIDE). THE PLATE IS FASTENED TO THE WALLWITH LIQUID NAILSROOF FLASHING, TYP.SUPPLY DUCT:CARBON STEEL NOT LESS THAN 16GAOR STAINLESS STEEL NOT LESS THAN18GADUCT CLEANOUTS AT CHANGE INDIRECTIONS, TYP.STAINLESS STEEL CLOSURE PANELSTAINLESS STEELFILTERS2'-3"1'-9"4'-0"2'-5"08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.1SCALE:1/4":1'0"ELEVATION05SCALE:1/4":1'0"ELEVATION06SCALE:1/4":1'0"ELEVATION07SCALE:1/4":1'0"ELEVATION08SCALE:3/4":1'0"KITCHEN HOOD SECTION09SCALE:1/2":1'0"ADA COUNTER DETAIL SOLID SURFACECOUNTER TOP1'-0"2'-10"4"PROVIDE CONCEALEDMETAL SUPPORTBRACKETS @24" O.C.2X4DOUBLETOP PLATE1'-6"2" STAINLESS STEELWRAP AROUNDOPENING10'-0" 2'-10"SLOPEDSHELVING DONUTDISPLAY RACKCHALKBOARD; FIELD VERIFYDIMENSIONS AND MOUNTINGHEIGHT WITH GC; PROVIDEDBY GCU/C REFw/GLASS DOORS/S STAGINGTABLECOFFEESTATION08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.2SCALE:1 1/2"=1'-0"CUSTOMER COUNTER DETAILSCALE:1/4":1'0"ELEVATION10 1220 Minimum Passage Width for One WheelchairInternational Symbol of Access for Hearing LossWheelchair TransferFig. A6Positions on toilet.Side Approach(b)3Transfers.armrest, sets brakes.Takes transfer position, removes21Diagonal Approach(a)brake.Positions on toilet, releases90 to the toilet).people fold chair or pivot itway, changes position (someMoves wheelchsir out of the43Removes armrest, transfersbrakes.footrest out of the way, setsTakes transfer position, swings2145510551842455455-7601818-301/2 max1/2 maxCane Technique6150150627655 Objects Mounted on Posts or PylonsProtruding Objects (Continued)Fig. 8 (d)Fig. 8Elevationcane range12 max305cane rangethis overhang can begreater than 12 (305)because no one canapproach the objectfrom this directionPlanProtruding ObjectsWalking Perpindicular to a Wall30512 maxFig. 8Fig. 8 (b)cane range1506long dimensionroute of travelperpindicular toGrating OrientationFig. 8 (h)Fig. A436-60 pace915-1525 6150Fig. 302.2Carpet Pile Thickness13GratingsFig. 8 (g)1360 min cane hits post or pytonbefore person hits objectLimits of Protruding ObjectsFig. 307.2preater than 27685 X>80 min.2030higher than 2768568527 max.27 or below685 Lobby4 max.10048122048 max 20 maxclear widthany amount481220XZ30760ElevationDETECTIONFig. 8 (c) freestanding Overhanging ObjectsFig. 307.4 Vertical Clearance AREACANEarea fromcross-trafficprotect shadedPlan2030predominant directionof trafficX<8068527 685 27 max.greater than 12305greater than 1230648 min.UNOBSTRUCTED FORWARD REACH15 min.48 max1220380FIGURE 308.2.148122048122030760 48 min.Lavatory ClearanceFig. 31depthclearancetoe43015017 min.6 max.2058 min.clearanceknee1015 865 735685230 40 max. 34 max.29 min.27 min.9 min.604.1.8.6Clear Floor Space Lavatories122048 min.clearfloorspace19 max.76030 min.48517 min.430door locationapproach only,42 min. latchother approaches81532 min.1004 max.81532 min.4 max.100 alternateClear Floor Space at Water ClosetsFig. 604.360 min.1525clearfloorspace142056 min. 54 min.Front Approach, Pull Side48 min.Front Approach - Sliding DoorsMinimum Clear Floor Space for WheelchairsSpace Requirements for WheelchairSeating Spaces in SeriesFig. 46(b)Side Access167566 min.1525 Additional Maneuvering Clearances for AlcovesFig. 4(e)maneuvering clearance of 12 in (305 mm) shall beNOTE:if x 15 in (380 mm), then an additionalprovided as shown.481220X 30512provided as shown.maneuvering clearance of 6 in (150 mm) shall beNOTE:x 24 in (610 mm), then an additionaland One Ambulatory PersonFig. a148 min. 1220 Forward or Rear Access(a)66 min.1675160760306X NOTE:x 15 in (380 mm.)30 760 601525X>15 Fig. 2Minimum Clear Widthfor Two Wheelchairs60 min.1525NOTE:x 24 in (610 mm).48 1220 76036X>24 34 max.Obstructed High Side Reach Drinking Fountains and Water CoolersFig. 27Fountain or Cooler1220 48 min.built-in(d)76030 min.fountain depthnot to exceed(a) Shelves10 max.535adjustable range 15 min. 380 48 max. 1220 Fig. 308Side ReachFig. 308.3.2865 48 max(c)Fountain or Coolerfreestanding1220 48 min.Clear Floor Space30 min.760610(b)24 max.760 30 min.76030255-610>10-24 MAX1170 46 max 60 min.Unobstructed Side Reach15 mine 380 Fig. 308.3.11220 1370Latch Side Approach - Sliding Doors and Folding DoorsManeuvering Clearances at Doorways Without Doors, and Folding DoorsSlide Side Approach - Sliding Doors1065 42 min.Fig. 404.2.4.2(f)(a)and Folding Doors1220 24 min.61042 min. 1065 (b)Maneuvering Clearances at Manual Swinging Doors and Gates1370 Fig. 404.2.4.1Front Approach, Push Side42 min.1065(d)22 min.56054 min.1065 42 min.18 min.1525 45548 min. 1220 Doors in Series and Gates in Series Fig. 404.2.6desk armWheelchair Turning SpaceFig. 3Fig. 304.3.212 min.91536 min.12 min.1525 60 min. 915 36 min.60-in (1525-mm)-Diameter Space(a)152560 min.1525 60 min.NOTE: Footrest may extend further for tall peopleDimensions of Adult-Sized Wheelchairsaccessible path of travelMinimum Clearances for Seating and TablesMinimum Clear Widthof an Accessible Route91536 min.Fig. 403.5.132 min.815for min. clearance 24 max. depth Forward760(b)3048 1220 Parallel(a)481220760 30 International SymbolsInternational TDD Symbol30760255Clear Floor Space10 max.1506 max.equipment permitted in shaded area122048 min.430-48517-19Knee ClearanceSpout Height and2058 min.307 & 6029 min.430-48517-1936 max. AFF 685 230 27 min. 915 Parallel Approach10 max.25576030(a)7603048 1220 48530760 Fig. 4591519 3648548591519193612204830 760 1220 48 3076048 1220 421065760 30 Fig. 305.348 MIN122036 915 30 76030 760 handlearmrestSignage HeightInternational Symbol of AccessibilityInternational Symbol of AccessibilityDisplay ConditionsFig. 703.7.2.160" MAX. (1525) (measured from the baseline of the highest tactile character)Braille Pictogram710710Maximum Doorway DepthClear Width of Doorways 48 min.1220815(c)Folding Door32 min.Fig. 404.2.3Detail815(b)32 min.Sliding Door24 max.48 min.1220(e)610 Hinged Door81532 min.(a)Fig. A3 (a)78 min.1965Space Needed for Smooth U-turn in a wheelchair32 min.815685 19 485 27 43-51 1090-1295 8 205 18 455 seattoelapLC81532 min.Fig. A260 min. 1525 LC30eye level9 LC30LCLC24712 ra d i u s 1 7 48LC LC246 ra d i u s7173 1 48LC54 max. 1370Fig. 54Tableware Areas36 min.91534 max. 865Fig. 53Food Service Lines1220 48 max.21 max.Fig. 38(b) Closets535Storage Shelves and ClosetsT-Shaped Turning SpacePosition of Clear Floor or Ground SpaceFig. 305.5Forward ApproachFig. 305.7.1Parallel ApproachFig. 305.7.2Maneuvering Clearance in an Alcove 48 1220 (a)Front Approach, Push Side(b)Hinge Approach, Pull Side(e)Hinge Approach, Push Side(f)Sliding Doors, Gates, and Folding Doors22 min.5603805 max12515 minFig. 602.5Drinking Spout Location15 min. 380Fig. 604.7DISPENSER OUTLET LOCATIONWATER CLOSET LOCATIONFig. 604.2405-45516-18CL(a) wheelchairaccessible water closetWATER CLOSET LOCATIONFig. 604.2430-48517-19CL(b) ambulatoryaccessible water closet7-948 max. 1220180-230CL56 min.1420 60 min.1525Wheelchair Accessible Toilet Compartment DoorsFig. 604.8.1.2Size of Clearance at Water ClosetsFig. 604.3.1Wheelchair Accessible Toilet Compartment Toe ClearanceFig. 604.8.1.49 min.230 6 min.150partition12 min.305 6 min.150partition(b)elevationchildren(a)elevationadult(c)plan6 min.150 6 min.15060 min.1525Size of Wheelchair Accessible Toilet CompartmentFig. 604.8.1.1(a)adult wall hungwater closet56 min.1420 60 min.1525(b)adult floor mounted water closetand childern's water closet59 min.1420 60 min.1525Wheelchair Accessible Toilet CompartmentFig. 604.8.1.6in New Construction48" (1220) MAX. (measured from the baseline of the lowest tactile character)Height of Tactile characters above Finish Floor or GroundFig. 703.4.1Fig. 703.7.2.2Fig. 703.7.2.4Volume Telephone ControlFig. 703.7.2.348 min. 122012 minFront Approach, Push Side(c)306door provided with bothcloser and latch36 min60 min915 1525 48 min. 1220 22 min.1065Hinge Approach, Pull Side(g)Latch Approach, Pull Side(h)24 min.106548 min. 1220door provided with bothcloser and latch54 min. 1370 24 min.610Latch Approach, Pull Side(i)door provided with closer24 min.6101065 42 min.Latch Approach, Push Side(j)24 min.6101220 48 min.Latch Approach, Push Side(k)door provided with closerTO REFLECTING SURFACE 1220 510UNOBSTRUCTED FORWARD REACHFIGURE 308.2.148122044 max >20-25 max1120 510-635(a)(b)74 min.FOR REFERENCEONLY; REFER TOFLORIDAACCESSIBILITYCODE 7th EDITION(2020) FOR BUILDINGCONSTRUCTIONURINALSCREENWALL HUNGWALL HUNG13 1/2" min.34513 1/2" min.34517" max.43013 1/2" min.345(a)wall hung type(b)stall typeHeight and Depth of UrinalsFig. 605.23691636 916 36 916481220 back wallCLCLcontrolwallseatwallCLNote: inside finished dimensions measured at the center pointsof opposing sidesTRANSFER TYPE SHOWER COMPARTMENT SIZE AND CLEARANCEFig. 608.118455controlwallseatwallbackwallGRAB BARS FOR TRANSFER TYPE SHOWERSFig. 608.3.1side (control)CLwall48 1220 38 965 15 max455TRANSFER TYPE SHOWER COMPARTMENT CONTROL LOCATIONFig. 608.5.122-23560-585seatwallL-SHAPED SHOWER SEATFig. 610.3.214-15 355-38015-16380-405seatwall1 1/2" max 382 1/2" max64(a)size(b)distance from wallseatwallcompartmententry3" max 75(b)L-shapedEXTENT OF SEATFig. 610.342 min.12 MAX12 min.24 min.305610Rear WallFig. 604.5.233-36 305840-915840-915Side Wall106517-19430-48633-36 36 min.91554 min.1370CLREAR WALL GRAB BAR WATER CLOSETSCONTROLS604.6 - CONTROLS SHALL BE MOUNTED ON THE OPEN SIDE OF THE WATER CLOSET EXCEPT IN AMBULATORY ACCESSIBLECOMPARTMENTS COMPLYING WITH 604.8.2Fig. 604.5.1SIDE WALL GRAB BAR WATER CLOSETSTRANSFER SIDEFINISH FLOORGRIPPING SURFACEFINISH FLOORGRIPPING SURFACE08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 CASCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ACCESSIBILITY GUIDELINES A-6 THE BUILDING IS CONSTRUCTED WITH LOAD-BEARING CMU EXTERIOR WALLS AND WOOD ROOF TRUSSES. OCCUPANCY CALCULATIONSPER NFPA LIFE SAFETY 101THE PROJECT IS A TENANT BUILD-OUT FOR ISLAND DONUTS.STANDING SPACE = 5 SQ. FT. PER PERSONNET. = 61SF / 5 SF= 13 PEOPLEKITCHEN = 200 SQ. FT. (FBC) 100 SQ. FT. (NFPA) PER PERSONNET. = 581 SF / 100 = 6 PEOPLE; 581 SF / 200 = 3 PEOPLE13 PEOPLETOTALSCALCULATIONS 25 PEOPLE06 PEOPLE1234SEATING ACTUAL = 25 PEOPLE01 PERSONWALK-IN + STORAGE = 300 SQ. FT. PER PERSONNET. = 92 SF / 300 SF= 1 PERSON13 PEOPLETOTALS 25 PEOPLE03 PEOPLE01 PERSON TOTAL OCCUPANT LOAD: 45 PEOPLEINDOOR SEATING = 15 SQ. FT. PER PERSONNET. = 595 SF / 15 SF= 40 PEOPLEFFPC/NFPA 101FBC 42 PEOPLE4 PERSON TABLES: 4 x 4 = 16 SEATSBAR STOOLS: 9 x 1 = 09 SEATSTENANT AREA:2,032 SF THE BUILDING IS NOT EQUIPPED WITH AN AUTOMATIC SPRINKLER SYSTEM.FLORIDA BUILDING CODE 7th EDITION (2020)FLORIDA BUILDING CODE - ACCESSIBILITY 7th EDITION (2020) FLORIDA FIRE PREVENTION CODE 7th EDITION (2020) (ENCOMPASSING THE 2018 EDITIONS OF NFPA 1 & NFPA 101)CONSTRUCTION: FBC SECTION 602.2 - TYPE IIB, UNPROTECTED, NON-SPRINKLEREDALLOWABLE HEIGHTS AND BUILDING AREAS: TABLE 504 - TYPE IIBALLOWABLE AREA (NS) - 23,000 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 3BUSINESS (B):OCCUPANCY CLASSIFICATION (FBC): BUSINESS (B) FBC 304.1; NFPA 3.3.40, 3.3.196.3 AND CHAPTER 38(NEW BUSINESS OCCUPANCIES). SECTION 302.1.1 SMALL BUILDINGS AND TENANT SPACES: A BUILDING OR TENANT SPACE USED FOR ASSEMBLY PURPOSES WITH AN OCCUPANT LOAD OF LESS THAN 50 PERSONS SHALL BE CLASSIFIED AS A GROUP B OCCUPANCY. OCCUPANCY CLASSIFICATION (FFPC): MERCANTILE (M) FBC 309.1; NFPA 3.3.182, 3.3.196.9 AND CHAPTER 36(NEW MERCANTILE OCCUPANCIES). ALLOWABLE AREA (NS) - 12500 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 2MERCANTILE(M): A.3.3.196.9 MERCANTILE OCCUPANCY: OCCUPANCIES INCLUDE THE FOLLOWING: RESTAURANTS WITH FEWER THAN 50 PERSONS.TYPE IIB - TABLE FBC 601STRUCTURAL FRAMEINCLUDING COLUMNS, GIRDERS, TRUSSESBEARING WALLSEXTERIORINTERIORNONBEARING WALLS AND PARTITIONSEXTERIORNONBEARING WALLS AND PARTITIONSINTERIORFLOOR CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSROOF CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSBUILDING ELEMENT0TYPE IIB00000TYPE IIB - TABLE FBC 602OCCUPANT LOAD:MINIMUM OCCUPANT LOAD - NFPA TABLE 7.3.1.2 & 12.1.7:OFFICE: 150 GROSS SF PER PERSONCOMMERCIAL KITCHEN (PREP AREA & BAR): 100 GROSS SF PER PERSON (FFPC) OR 200 GROSS SF PER PERSON (FBC)STORAGE, STOCK, WALK-IN COOLER: 300 GROSS SF PER PERSONQUEUING AREA: 5 NET SF PER PERSONUNCONCENTRATED (TABLES AND CHAIRS) = 15 SQ. FT. PER PERSON < 5FIRE SEPARATION DISTANCE > 5< 10> 10< 30> 30(FT)TYPE OF CONSTRUCTIONOTHERSOTHERSIIBALLGROUP B1100GROUP M2100CLASS A INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 0-25; SMOKE DEVELOPED 0-450CLASS B INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 26-75; SMOKE DEVELOPED 0-450CLASS C INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 76-200; SMOKE DEVELOPED 0-450MEANS OF EGRESS:OCCUPANCYMINIMUM AS REQUIRED BY FBC TABLE 803.11 (NON-SPRINKLERED):VERTICAL EXITSEXIT ACCESS CORRIDORSROOMS & ENCLOSED SPACESINTERIOR FINISHES:AS REQUIRED BY FFPC TABLE A.10.2.2:OCCUPANCYEXIT ACCESSOTHER SPACESMERCANTILEABCMERCANTILEA OR BA OR BA OR BVERTICAL EXITSEGRESS WIDTH PER PERSON SERVED:OTHER EGRESS COMPONENTS (CORRIDORS, RAMPS, ETC.) = 0.20" (FBC 10005.3.2)MINIMUM CLEAR WIDTH OPENING OF EXIT DOORS: 32" (32"/0.2" PER PERSON = 160 PERSONS)DOORS SHALL SWING IN THE DIRECTION OF EGRESS EXCEPT WHEN SERVING AN MINIMUM CORRIDOR AISLE WIDTH: 44" OCCUPANT LOAD OF LESS THAN 50 (FBC 1010.1.2.1)MAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): MERCANTILE - 200 FT FBC TABLES 1017.2 & 1020.4, & TABLE 1020.2:MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)MEANS OF EGRESS:NFPA 101 - 150 FT (MERCANTILE FFPC A.7.6)NFPA 101 - 20 FT (MERCANTILE FFPC A.7.6)MAXIMUM TRAVEL DISTANCE, DEAD END LENGTH, EXIT AND MEANS OF EGRESS WIDTH: COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (MERCANTILE) FFPC A.7.6CORRIDOR FIRE-RESISTANCE RATING (FBC TABLE 1020.1): GREATER THAN 30 OCCUPANTS w/o SPRINKLER SYSTEM - 10 (MERCANTILE - FFPC 36.3.6.1 EXCEPTION 1)(0.20" x 42 OCCUPANTS = 8.4" STAIR WIDTH REQUIRED)I OR IINABUSINESSABCBUSINESSA OR BA OR BA, B OR CMAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): BUSINESS - 200 FT NFPA 101 - 200 FT (BUSINESS FFPC A.7.6)MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)NFPA 101 - 20 FT (BUSINESS FFPC A.7.6)COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (BUSINESS) FFPC A.7.61 (BUSINESS - FFPC 38.3.6.1)EXISTING 1 HR FIRE RATED DEMISING WALLPERSONS (P) DISCHARGING AT EXIT OR EXIT ACCESS,AND EGRESS CLEAR WIDTH (AT DOORS).INDICATES EXIT OR EXIT ACCESS, NUMBER OFSAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM TRAVEL DISTANCE TO AN EXTINGUISHER = 75 FTMAXIMUM FLOOR AREA PER 2A UNIT = 3,000 SFMAXIMUM FLOOR AREA PER EXTINGUISHER = 11,250 SFAND EGRESS CLEAR WIDTH (AT DOORS).SAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM FLOOR AREA PER UNIT OF A = 1,500 SFFECSERIES CABINETS. CLEAR BUBBLE, BLACK LETTERS PROVIDE FIRELOCATED IN 2 1/2" ROLLED EDGE, SEMI-RECESSED, CAMEOFEC- FIRE EXTINGUISHER & CABINET FIRE EXTINGUISHERSCLASS A FIRES (ORDINARY COMBUSTIBLE MATERIALSSUCH AS WOOD, CLOTH, PAPER RUBBER AND MANY PLASTICS)CLASS B FIRES (LIQUIDS, TARS, OILS, GASES)CLASS C FIRES (ELECTRICAL EQUIPMENT)FIRE EXTINGUISHER TYPE "A" (UL RATING 3A-40B:C) 5 LB MULTIPURPOSE DRY CHEMICALEQUAL TO BADGER MODEL #5MB-6H (A KIDDE COMPANY)FIRE EXTINGUISHER TYPE "B" (UL RATING 2-A:K) 6 LITER (1.56 GAL) EXTINGUISHER FOR CLASS K FIRESEQUAL TO KITCHEN ONE MODEL #KS-6000 BY PYRO-CHEMCLASS K FIRES (COOKING MEDIA - VEGETABLE OR ANIMAL OIL AND FATS)FIRE EXTINGUISHERS SHALL BE CERTIFIED BY A LICENSE FIRE PROTECTION COMPANYWATER CLOSETS BUSINESS (B)21 MALES21 FEMALESTOTAL OCCUPANT LOAD BUSINESS - 42LAVATORIES1 LAV PER 100DRINKINGFOUNTAINS2 REQUIRED WATERCLOSET2 REQUIRED LAVATORIES1 WC PER 25 MALE/FEMALE FOR FIRST 50 AND 1 PER 80 FOR REMAINDER EXCEEDING 801 SERVICE SINKSERVICE SINK1 LAV PER 40 MALE/FEMALE FOR FIRST 80 AND 1 PER 50 FOR REMAINDER EXCEEDING 50PLUMBING FIXTURE COUNT PER TABLE 403.1 FLORIDA PLUMBING CODESEPARATE FACILITIES (FLORIDA PLUMBING CODE SECTION 403.2):EXCEPTION 04: SEPARATE FACILITIES SHALL NOT BE REQUIRED INBUSINESS OCCUPANCIES IN WHICH THE MAXIMUM OCCUPANT LOAD IS 25 OR FEWER.3"-4"31 2"RECESSED REMOTE FIRE PROTECTIONPULL STATION DETAILBOX AND CONDUIT INSTALLED AND SECURED BY ELECTRICAL CONTRACTORFIRE SYSTEM INSTALLATION SHALL BE BY AUTHORIZED ANSUL DISTRIBUTORREMOTE FIRE SYSTEM PULLDETAIL RFP-1PULL08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CODE DATA G-1ARCHITECTURALMECHANICALPLUMBINGPLUMBING LEGEND AND PROJECT NOTESP-1ELECTRICALPLUMBING SCHEDULESP-2PLUMBING PLANSP-3DOMESTIC WATER PLANP-4PLUMBING GAS PLAN AND GAS RISERP-5M-1 MECHANICAL NOTES, LEGEND AND ABBREVIATIONSM-2 MECHANICAL SCHEDULESM-3 MECHANICAL PLANM-4 MECHANICAL DETAILSG-1 CODE DATAG-2 LIFE SAFETY PLANA-1 EXISTING FLOOR PLANA-1.1 DEMOLITION FLOOR PLANA-2 FLOOR PLAN & GENERAL NOTESA-2.1 WALL FINISH PLANA-2.2 FLOOR FINISH PLANA-2.3 ROOF PLANA-2.4 EQUIPMENT SCHEDULEA-3 EXISTING REFLECTED CEILING PLANA-3.1 REFLECTED CEILING PLANA-4 ENLARGED TOILET ROOM PLANA-4.1 DOOR & HARDWARE SCHEDULEA-5 INTERIOR ELEVATIONSA-5.1 INTERIOR ELEVATIONSA-5.2 INTERIOR ELEVATIONSA-6 ACCESSIBILITY GUIDELINESPLUMBING DETAILSP-6SANITARY RISERSP-7E-1 POWER PLANE-2 LIGHTING PLANSCALE: N.T.SSITE MAPPROJECT SITEPLUMBING SCHEDULESP-2.1PLUMBING DETAILSP-6.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"17" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK160P32"NOTE A160P32"NOTE A160P32"NOTE A160P32"NOTE AEXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 EXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 29'26'25'33'FEFEFENOTE A:EXIT DOOR TACTILESIGNAGE READING:EXITSIGNAGE SHALLCOMPLY w/ANSI/CABOA117.1; MOUNT 60" AFFTO CENTERLINE OF SIGNDOORS NOT REQUIRING SPECIAL TOOLSLOCKS ON EXIT DOORS SHALL NOT REQUIRETHE USE OF A KEY, A TOOLOR SPECIAL KNOWLEDGE OR EFFORTFOR OPERATION FOR OPERATION FROMEGRESS SIDE UNLESS THEY MEET THEREQUIREMENTS OF NFPA 101 7.2.1.5.ON THE TENANT'S SUITE. LETTERS PROVIDE MIN 6" HIGH LETTERSTHE STREET THEREFORE THE ADDRESS NUMBER MUST BE VISIBLE & LEGIBLE FROM MAY NEED TO BE LARGER THAN THE MINIMUMOF 6" - COORD w/ FIRE MARSHAL315 SF PERPERSON25 PEOPLE595 SF5 SF PER PERSON13 PEOPLE61 SF12581 SF200 SF PERPERSON (FBC)3 PEOPLE100 SF PERPERSON (FFPC)6 PEOPLE4300 SF PERPERSON1 PEOPLE92 SFE1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"16" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK234408-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 LIFE SAFETY PLANSCALE:1/4":1'0"LIFE SAFETY PLANG-2SCALE:1/4":1'0"OCCUPANCY CALCULATIONSmercantile mercantile K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHU08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING FLOOR PLANA-1 K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHUREMOVE EXISTINGWALLSREMOVE EXISTINGOVERHEADREMOVE EXISTINGWALLSREMOVE EXISTINGWALLSREMOVEEXIST.PLUMBINGFIXT.REMOVEEXIST. DOOR& MILLWORKREMOVE EXISTINGWALLS07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DEMOLITION PLANSCALE:1/4":1'0"DEMOLITION PLANA-1.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER101101A103107108109101B10501*01010101020202010101*01*33214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242550101011828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.17" DEEP COUNTER10. DIMENSIONS NOTED AS "CLEAR" ARE FROM FACE OF GYPSUM WALLBOARD TO GYPSUM WALLBOARD.GENERAL NOTES3. THIS BUILDING WILL BE A NONSMOKING FACILITY.4. ALL WORK SHALL BE IN COMPLIANCE WITH THE BUILDING CODES, RECOGNIZED INDUSTRY STANDARDS, CRAFTSMANSHIP STANDARDSIN THE AREA, AND ALL MANUFACTURER'S RECOMMENDATIONS.5. THERE SHALL BE A FLOOR OR LANDING ON EACH SIDE OF A DOOR. SUCH FLOOR OR LANDING SHALL BE AT THE SAME ELEVATION ON EACH SIDE OF THE DOOR. LANDINGS SHALL BE LEVEL EXCEPT FOR EXTERIOR LANDINGS WHICH ARE PERMITTED TO HAVE A SLOPE NOT TO EXCEED 0.25 UNIT 6. FIELD VERIFY ALL DIMENSIONS AND EXISTING CONDITIONS PRIOR TO CONSTRUCTION. REPORT ANY AND ALL DISCREPANCIES TO THE ARCHITECT/ENGINEER.8. CONTRACTOR SHALL PERMANENTLY IDENTIFY ALL FIRE-RESISTANT-RATED WALLS (AND CORRESPONDING FIRE-RESISTANT RATINGS)INCLUDING FIRE BARRIER WALLS, SMOKE BARRIER WALLS, FIRE PARTITIONS, FIRE WALLS, AND SHAFT ENCLOSURES EITHER BYINSTALLING SIGNS OR BY STENCILING IN CONCEALED SPACES THE FOLLOWING: ( ) HOUR FIRE AND SMOKE RATED BARRIER -PROTECT ALL OPENINGS. IDENTIFICATION SHALL BE SPACED NO MORE THAN TWELVE (12) FEET ON CENTER WITH A MINIMUMLETTER SIZE OF TWO (2) INCHES IN HEIGHT ON A CONTRASTING BACKGROUND9. DO NOT SCALE DRAFTING, REPORT ERRORS IN DIMENSIONING TO ARCHITECT BEFORE PROCEEDING WITH WORK.2. SELF CLOSING DEVICES SHALL BE PROVIDED ON DOORS IN A MEANS OF EGRESS AND SHALL MEET THE REQUIREMENTS OF THENFPA LIFE SAFETY CODE 101 (2018) CHAPTER 7.2.1.8 AND THE FLORIDA FIRE PREVENTION CODE 7th EDITION.1. SWING & FORCED OPEN DOORS SHALL MEET THE REQUIREMENTS OF NFPA LIFE SAFETY CODE AS FOUND IN THE FLORIDA FIRE PREVENTION CODE 6th EDITION CHAPTER 7.2.1.4 AND THE FLORIDA BUILDING CODE 7th EDITION (2020) 1008.1.2.VERTICAL IN 12 UNITS HORIZONTAL (2% SLOPE). FBC 1010.1.57. THE GENERAL CONTRACTOR SHALL PROVIDE FLORIDA PRODUCT APPROVAL NOTICES ON ALL REQUIRED COMPONENTS AND CLADDING.11. PLANS FOR FIRE-PROTECTION SPRINKLER SYSTEM (NOT PROVIDED BY DSAE), INCLUDING SUPPORT DETAILS, SHALL BEREVIEWED AND APPROVED BY THE LOCAL AUTHORITY PRIOR TO INSTALLATION FOR COMPLIANCE WITH THE FLORIDA BUILDING CODE7th EDITION (2020) AND NFPA 13 (LATEST EDITION).1. THE CONTRACTOR SHALL VISIT, BEFORE SUBMITTING PRICES. GENERAL NOTES - FINISHES2. ALL INTERIOR DOOR FRAMES SHALL BE PAINTED.3. ALL INTERIOR PARTITIONS SHALL RECEIVE TWO COATS OF SHERWIN WILLIAMSSEMI-GLOSS PAINT OVER ONE COAT OF PRIMER UNLESS OTHERWISENOTED. 4. ALL HORIZONTAL GYPSUM BOARD SURFACES SHALL BE PRIMED WITHFLAT WHITE FINISH, UNLESS OTHERWISE INDICATED.5. FLOOR TRANSITIONS SHALL OCCUR AT THE CENTERLINE OF DOORS. SUBMIT SAMPLES FOR OWNER'S SELECTION PRIOR TO INSTALLATION.6. CENTER FLOOR TILES IN ROOM, UNLESS OTHERWISE NOTED.7. ALL LEFT OVER PAINT SHALL BE CLEARLY LABELED AND APPROPRIATELYPACKAGED. CONTRACTOR SHALL DELIVER ALL LEFTOVER PAINT AND FINISHMATERIALS TO TENANT FOR STORAGE.8. ALL INTERIOR FINISHES TO BE THE MINIMUM CLASSIFICATION AS LISTED ON THECODE DATA SHEET.NOTES:1. MEASURING 8" HORIZONTALLY AND 8 INCHES VERTICALLY, OF A BRIGHT RED REFLECTIVE COLOR.2. THE SYMBOL SHALL BE PLACED WITHIN 24" TO THE LEFT OF THE MAIN ENTRY DOOR .3. BE PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE ON ACONTRASTING BACKGROUND.4. BE MOUNTED ON A CONTRASTING BASE MATERIAL WHICH IS THEN PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE.5.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR FINISHED FLOOR TO THE BOTTOM OF THE SYMBOL SHALL NOT BE LESS THEN 4FEET (48").6.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR THE FINISHEDFLOOR TO THE TOP OF THE SYMBOL SHALL BE NOT MORE THAN 6' (72 IN.)8"8"07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR PLANSCALE:1/4":1'0"FLOOR PLANA-2NOTESINSULATIONTYPEWALL TYPE SCHEDULEDESCRIPTION2. EXPOSED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 25 ANDA SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.3. CONCEALED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 75 AND A SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.NOTES:5. PROVIDE WOOD BLOCKING AS REQUIRED TO SUPPORT TOILET ROOM FIXTURES, ACCESSORIES, SHELVES & CABINETS, FIRE EXTINGUISHERS, ETC. WOOD BLOCKING IN FIRE-RATED WALLS SHALL BE FIRE-RATED. 6. PROVIDE R-11 SOUND ATTENUATION BATT AROUND THE TOILET ROOMS.1. PROVIDE FIREBLOCKING AND DRAFTSTOPPING IN PARTITIONS PER FBC 717. PROVIDE FIREBLOCKING IN CONCEALED WALL SPACES INCLUDING VERTICALLY AT THE CEILING AND FLOOR LEVELS AND HORIZONTALLY AT INTERVALS NOT EXCEEDING 10' (FBC 717.2.2). SEE FBC 717.2.1 FOR FIREBLOCKING MATERIAL OPTIONS.COMBUSTIBLE WOOD BLOCKING IN NON FIRE-RATED WALLS IS PERMITTED 4. PROVIDE WATER RESISTANT GYPSUM BOARD AROUND PLUMBING FIXTURES AND WALLS TO RECEIVE CERAMIC TILEEQUAL TO USG'S FIBEROCK'S BRAND AQUA-TOUGH INTERIOR PANELS. GYPSUM WALLBOARD PRODUCTS MUST BE RATED FOR WET LOCATIONS IN ACCORDANCE WITH THE TILE COUNCIL OF NORTH AMERICA (TCNA) HANDBOOK. GREEN BOARD IS NOTAPPROVED FOR TOILET ROOM LOCATIONS.133 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON EACH SIDE; EXTEND WALL 6" ABOVE THER-11NEW 3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE; EXTEND WALL 6" ABOVE THER-132NEW 6", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDR-133/8" AIR GAP FROM EXISTING CMU WALLADJACENT CEILINGADJACENT CEILING1/2" AIR GAP FROM EXISTING CMU WALLON ROOM SIDE; EXTEND WALL 6" ABOVE THEADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/2401*3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE AND 1/2" PLYWOOD ON KITCHEN SIDER-11EXTEND WALL 6" ABOVE THE ADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240 ROOM FINISH SCHEDULESEATING AREAFLOORBASEWALLSCEILINGCEILINGHEIGHTREMARKS101RSRESILIENT WALL BASEVCTVINYL COMPOSITION TILEACTACOUSTICAL CEILING TILES/SSTAINLESS STEEL PANELS====PTPAINT=FRPFIBERGLASS REINFORCED PANEL=CTCERAMIC TILE=SCSTAINED CONCRETE=EPEPOXY PAINT=QTQUARRY TILE=107WOMEN'S TOILET ROOMROOM NAMEPROVIDE MOISTURE RESISTANT GYPSUM WALLBOARD (ASTM C630/630M) IN WASH DOWN AND WET AREAS; COORD w/OWNER'S REPACOUSTICAL CEILINGS SHALL COMPLY w/ THE FOLLOWING: ASTM C635, ASTM C636, ASTM C665, ASTM E580, ASTM C1284 AND CEILINGS AND GYPSUM BOARD:PROVIDE TILE BACKER BOARD (DEN-SHIELD OR APPROVED EQUAL) ON WALLS TO RECEIVE CERAMIC TILE (ASTM C1178)PROVIDE FIRE RATED GYPSUM BOARD TYPE "X" 5/8" THICK ON FIRE RATED PARTITION (ASTM C36) INSTALLED PER UL ASSEMBLY REQUIREMENTSACOUSTICAL CEILING TILES:PROVIDE ACOUSTIC INSULATION (ASTM C665) AROUND ALL TOILET AND BATHROOMS AND AS NOTED ON THE WALL TYPE SCHEDULE. INSULATION INSULATION:SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED R-11 MIN.PROVIDE BATT INSULATION (ASTM C665) IN EXTERIOR WALLS AND SOFFIT AREAS WITH R-VALUES AS NOTED ON PLANS AND SECTIONS. BATT INSULATION SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED.INSULATION SHALL HAVE FLAME/SMOKE PROPERTIES 75/450 IN ACCORDANCE WITH ASTM E84STUDS AND TRACKS (ASTM C645, GA-216, GA-600) SHALL BE GALVANIZED SHEET STEEL, 0.0188" THICK (25 GA), 0.284 (22 GA), 0.0359 (20 GA); FRAMING MATERIALS:ANCHOR TO SUBSTRATE WITH TIE WIRES, NAILS, SCREWS, AND OTHER METAL SUPPORTS, OF TYPE AND SIZE TO SUIT APPLICATION TO RIGIDLY METAL STUD INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: MAXIMUM DEFLECTION OF INTERIOR NON-LOAD BEARING PARTITIONS SHALL BE L/240 AT 5 PSF. PROVIDE LATERAL REINFORCING CEILING FRAMING INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: LEVEL CEILING TO A TOLERANCE OF L/600. LATERALLY BRACE ENTIRE SUSPENSION SYSTEM.GYPSUM BOARD INSTALLATION: INSTALLPER GA-216 & GA-600. ERECT EXTERIOR GYPSUM SHEATHING IN ACCORDANCE WITH ASTM C1280.PROVIDE A GYPSUM BOARD ACCESSORIES AS REQUIRED : ACOUSTIC SEALANT, CORNER BEADS, EDGE TRIM (GA-216), JOINT MATERIALS (ASTM C475 & GA-216) - REINFORCING TAPE, JOINT COMPOUND, ADHESIVE & WATER.GYPSUM BOARD FINISHES:LEVEL 1 - ABOVE FINISHED CEILINGS CONCEALED FROM VIEWLEVEL 2 - WALLS BEHIND CABINETRYLEVEL 3 - WALLS EXPOSED TO VIEWLEVEL 4 - CEILING EXPOSED TO VIEWLEVEL 5 - SPECIAL WALLS TO RECEIVE WRITING SURFACES, PAINTED MURALS, OR PROJECTION SCREENS.INTERIOR SYSTEMS CONSTRUCTION ASSOCIATION.INSTALLATION: INSTALL LAY-IN CEILING IN ACCORDANCE WITH ASTM C636 AND ASTM E580. INSTALL SYSTEM CAPABLE OF SUPPORTING IMPOSED LOADS TO DEFLECTION OF L/360 MAXIMUMACCESSORIES: PROVIDE ALL NECESSARY ACCESSORIES; GALVANIZED SUPPORT HANGERS AND CHANNELS, PERIMETER MOLDINGS (SAME MATERIAL AND FINISH AS THE GRID - L-SHAPED MOLDING FOR MOUNTING AT THE SAME ELEVATION AS FACE OF GRID)TOUCH UP PAINT AS REQUIRED TO MATCH GRID.INSTALL TILE PER THE TCA (TILE COUNCIL OF AMERICA) HANDBOOK FOR TILE INSTALLATION.CERAMIC AND QUARRY TILESECURE MATERIALS IN PLACE.AS REQUIREDNOTE:ALL FINISHES AND COLORS SHALL BE APPROVED BY OWNER PRIOR TO ORDERINGFINISHES:C-SHAPE, WITH KNURLED FACES.VINYL COMPOSITION TILE (VCT):VCT EQUAL TO ARMSTRONG STANDARD EXCELON SERIES; 12" x 12" x 1/8"1.1PERFORMANCE REQUIREMENTSA.Conform to applicable code for fire performance ratings as follows:1.Flooring, critical radiant flux (CRF): Minimum 0.45 watt per square centimeter, per ASTM E 648.2.Flooring, smoke developed: Maximum 450, per ASTM E662.3.Class 2 finish per ASTM F1066ORDER COUNTER102OFFICE103CONDIMENT AREA104KITCHEN/PREP/DW105WALK-IN COOLER106MEN'S TOILET ROOM108JAN CLOSET1092x2 SUSPENDED VINYLACOUSTICAL TILE & GRIDVBVINYL BASE=ALALUMINUM= (COORDINATE ANY LOCATIONS OF LEVEL 5 FINISH WALLS w/OWNER AND ARCHITECT PRIOR TO BIDDING)SCCTSCSCSCQTQTCTSCHEXAGON FLOOR TILESHEXAGON FLOOR TILESFRP/SS/PWADTPEP/CTEP/CTPWPLYWOOD=QTQT--------------VINYL ACTACTACTACTACTACTACTACT10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"SHIP LAP WALL SIDINGPTPTPTPTPT8'-0"ADTP4" INSULATED CEILING PANELSHIP LAP WALL SIDINGSHIP LAP WALL SIDINGWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105SUBWAY TILE (CT)PLYWOOD (PW)WALL FINISH LEGENDPAINT (PT)FIBERGLASSREINFORCEDPANEL (FRP)STAINLESS STEEL(SS)PLYWOOD(PW)BLOCKINGW/FRP WALLFINISHPAINT,TYP.STAINLESSSTEEL, TYP.SUBWAYTILE(CT)SUBWAYTILE(CT)FIBERGLASSREINFORCEDPANEL, TYP.PAINT,TYP.PLYWOOD(PW) BLOCKINGw/FRP WALLFINISHPLYWOOD(PW)BLOCKINGw/FRP WALLFINISHSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDING ONTOP AND BOTTOM OFWINDOWS, TYP.STAINLESSSTEEL, TYP.FRPSTAINLESSSTEELWRAPPEDOPENINGFRP WRAPPEDOPENING07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 WALL FINISH PLAN AND ROOM FINISH SCHEDULE A-2.1SCALE:1/4":1'0"WALL FINISH PLAN WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105QUARRY TILE(QT)STAINED CONCRETE(SC)FLOOR FINISH LEGENDHEXAGONALFLOOR TILE(CT)07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR FINISH PLAN A-2.2SCALE:1/4":1'0"FLOOR FINISH PLAN EXISTING TENANTSEPARATION FIRE WALLKITCHEN HOODBELOWEXISTING TENANTSEPARATION FIRE WALLCU-2CU-1PROVIDE LANDLORD APPROVEDCONDENSATE STANDS FORWALK-IN-COOLER & FREEZERCONDENSERSPROVIDE PERMANENT FALLARREST/RESTRAINT ANCHORAGECONNECTOR DEVICESCOMPLYING w/ANSI/ASSE Z 359PER FMC 304.11 EXCEPTION07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ROOF PLAN A-2.3SCALE:1/4":1'0"ROOF PLAN E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER3214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242551828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.17" DEEP COUNTER07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULESCALE:1/4":1'0"EQUIPMENT PLANA-2.4 07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULE A-2.5 WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104NOTE A:EXHAUST HOOD SYSTEMBELOW; FIT ACOUSTICALCEILING AROUND EXHAUSTHOOD; PROVIDE STAINLESSSTEEL CLOSURE PANELBETWEEN EXHAUST HOOD &ACOUSTICAL CEILINGNOTE AFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFF FFFF FFFF FFFF GYP. BD. & METAL STUDBULKHEAD @ 9'-6"BOTTOM OFSOFFIT @9'-7"FFFFFFFF 2x2 SUSPENDED ACOUSTICAL VINYL FACEDTILE & GRIDRECESSED CEILINGFIXTUREEMERGENCY EXIT LIGHTEXIT SIGN2 x 2 SUPPLY DIFFUSERGYPSUM WALLBOARD SOFFITCEILINGPENDANT FIXTURE2 x 4 LIGHT FIXTURE2 x 2 LIGHT FIXTUREEMERGENCYLIGHT2 x 2 RETURN AIREXHAUSTFANTRACK LIGHTINGw/PENDANTSWALLSCONCEFFFF FFFF EXH FANVINYL ACOUSTICAL CEILING TILE2 x 4 LIGHT FIXTURE w/BATTERY BACKUPFFFF 08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 REFLECTED CEILING PLANSCALE:1/4":1'0"REFLECTED CEILING PLANA-3.1 ATTIC ACCESSREMOVE EXISTING SOFFIT.BOTTOM OF SOFFIT @ 7'-10"REMOVE EXISTING DUCTREMOVE EXISTINGDUCTLESS HVAC UNITREMOVE EXISTING AIRHANDLER UNITREMOVE EXISTING LIGHTS,TYP.REMOVE EXISTING LIGHTS,TYP.REMOVE EXISTINGDIFFUSERS & DUCTS, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.EXISTING SLOPINGACOUSTICAL CEILING TILE &GRIDREMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.REMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.EXH FANACOUSTICAL CEILINGHEIGHT: 9'-10 58"GYP BOARD CEILINGHEIGHT ABOVE ACT: 11'-10 58"ACOUSTICAL CEILINGHEIGHT: 7'-4 18"ACOUSTICAL CEILINGHEIGHT: 9'-0"BOTTOM OF GYP BOARDCEILING 11'-9 78"REMOVE EXISTING EXITSIGNS, TYP.08-23-22ISLAND DONUTS TENANT BUILD-OUTSHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING REFLECTED CEILING PLANA-3 A-41243MEN'STOILET ROOM108A-456WOMEN'STOILET ROOM10708-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ETR PLAN & ELEVATIONS SCALE:1/2":1'0"ENLARGED TOILET ROOM PLANA-4SCALE:1/2":1'0"ELEVATION 01SCALE:1/2":1'0"ELEVATION 02SCALE:1/2":1'0"ELEVATION 03SCALE:1/2":1'0"ELEVATION 04SCALE:1/2":1'0"ELEVATION 05SCALE:1/2":1'0"ELEVATION 06TOILET ACCESSORY LEGENDNOTES1. HANDICAPPED ACCESS MOUNTINGDIMENSIONS ARE VERY CRITICALACCESSORIES TO BE IN ACCORDANCEMOUNTING LOCATION OF TOILETAND HAVE NO MINUS TOLERANCES.WITH A.D.A. TITLE III & FLORIDABUILDING CODE 7th EDITION (2020) -ACCESSIBILITY.WHERE THE TOILET IS FOR INDIVIDUAL USE AND CLEAR FLOOR SPACE COMPLYING WITHFBC-ACCESS 305.3 (A 30"x48" SPACE) IS PROVIDED WITHIN THE ROOM BEYOND THEARC OF THE DOOR SWING, DOORS SHALL BE PERMITTED TO SWING INTO THE CLEARFLOOR SPACE OR CLEARANCE REQUIRED FOR ANY FIXTURE (FBC-ACCESS 603.2.3 EXCEPTION 2)WHERE THE SPACE BENEATH AN ELEMENT IS INCLUDED AS PART OF THE CLEARFLOOR OR GROUND SPACE, THE SPACE SHALL COMPLY WITH FBC-ACCESSIBILITY306 FOR KNEE & TOE CLEARANCETHE SPACE BENEATH THE SINK COMPLIES WITH THIS REQUIREMENT FACE OF FINISH. FINISH THICKNESS 2. ALL DIMENSIONS SHOWN ARE FROM MUST BE ADDED TO ANY ROUGH IN DIMENSIONS.SURFACE MTD. SOAP DISPENSERDOUBLE TOILET PAPER HOLDERTOWEL DISPENSERSURFACE MTD. PAPERHANDICAPPED GRAB BAR24 x 36 MIRRORBASIS OF DESIGNCSI BATHWARE BAR-SB36-TW-125-MBBASIS OF DESIGNSUNERA BLACK PAPER TOWEL DISPENSERBASIS OF DESIGNNXHOME RECTANGULARw/ROUNDED CORNERSNotes: (Typical for All Signs)1.6" MIN HIGH BORDER DIMENSION ~ TACTILE MALE/FEMALE FIGURES.2.THE USE OF THE MALE/FEMALE TACTILE CARICATURES AREREQUIRED.3.LETTERS, NUMERALS, BRAILLE LETTERS AND PICTORIAL SYMBOLSSHALL BE RAISED 132" FROM THE BACKGROUND AND SHALL BE 58"MINIMUM TO 2" MAXIMUM IN HEIGHT.4.BRAILLE LETTERS SHALL BE RAISED IN GRADE 2 BRAILLE.5.CHARACTER PROPORTION AND HEIGHT TO w/ ANSI A117.1 SECTION703.6.COLOR CONTRAST SHALL COMPLY W/ ANSI A117.1 SECTION 703.3.12.7.THE SIGN HORIZONTAL CENTERLINE SHALL BE @ 60" AFF.8.THE SIGN LOCATION SHALL BE LOCATED ON THE WALL ORPARTITION TO THE STRIKE JAMB/LATCH SIDE OF THE DOOR.9.ALL SPECIFICATIONS FOR SIGNAGE MUST COMPLY W/ ICCA117.1-2009 CHAPTER 7, COMMUNICATION ELEMENTS ANDFEATURES.WOMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANTWOMEN'S RESTROOM SIGNS WITH TACTILE TEXT AND GRADE 2 BRAILLEWomens Restroom Braille ADA Signs - 6" x 8"ADA-1020; Color - White on BlueMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANT MEN'SRESTROOM SIGN WITH TACTILE TEXT AND BRAILLEMens Restroom Braille ADA Signs - 6" x 8"ADA-1021; Color - White on BlueBASIS OF DESIGNBGL TOILET PAPER HOLDER - BLACK STAINLESS BASIS OF DESIGNWEWBABY 27ozMATTE BLACK3. ALL TOILET ACCESSORIES SHALL BE(WELDED FRAME)STRAIGHT GRAB BAR, 36", MATTE BLACKCSI BATHWARE BAR-SB48-TW-125-MB STRAIGHT GRAB BAR, 48", MATTE BLACKSTEEL FINISH TOILET PAPER ROLL HOLDER WITH SHELF WALL MOUNTED FOR BATHROOM(BLACK, DOUBLE HEAD)400 C-FOLD / 525 MULTI-FOLD PAPER TOWEL *DIAPER CHANGING STATION MODEL - Koala Kare KB200-SS Horizontal Wall MountedBaby Changing Station / Table GREY 01 color TO OPERATE. LEVER-OPERATED MECHANISMS ARE ACCEPTABLE DESIGNS.HAND AND DOES NOT REQUIRE TIGHT GRASPING, TIGHT PINCHING, OR TWISTING OF THE WRISTOPERATING LEVER ON DOOR SHALL HAVE A SHAPE THAT IS EASY TO GRASP WITH ONE2. PROVIDE LEVER TYPE COMMERCIAL (ANSI A156.2, 1996, SERIES 4000, GRADE 1 )1. ALL INTERIOR DOORS TO BE FLUSH SOLID CORE WOOD DOORS (BIRCH), GRADE DOOR HARDWARE (ANSI A117.1 COMPLIANT).DOORS AND HARDWARE3'-0" x 7'-0" x 1 3/4" - PAINT FINISH. FRAMES SHALL BE PAINTED4. COORDINATE ALL KEYING & LOCKSETS WITH TENANT.STEEL (WELDED OR KNOCK-DOWN) - COORDINATE w/TENANT.1 1/2 PR BUTT HINGES3 DOOR SILENCERSPRIVACY LOCKSETANSI F76 BED/BATH PRIVACY LOCK; PUSH-BUTTON LOCKING. TURNING INSIDE LEVER RELEASES PUSH-BUTTON. CAN OPEN FROM OUTSIDE VIA EMERGENCY RELEASE1 WALL STOP3. ALL EXTERIOR DOORS & DOORS SHALL BE GALVANIZED, INSULATED (R-7) METAL DOORS w/GALVANIZEDMETAL FRAMES.DOOR: Level 1 - Standard-duty, Model 1, nominal 20 gage/0.032 inch (0.8 mm) face sheets, 1 3/4", full flush designDOOR FRAMES: Level 1 for Door Models 1, nominal 18 gage/0.042 inch (1.0 mm) thick material, base metal thickness.HARDWARE GROUP 1HARDWARE GROUP 21 OFFICE LOCKSET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F82 KEY OPENS LOCK FROM OUTSIDE,PUSH-BUTTON LOCKING FROM INSIDE,LATCH TURNING INSIDE RETRACTS LOCK1 WALL STOPHARDWARE GROUP 31 PASSAGE SET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F75 BOTH LEVERS ALWAYS UNLOCKED1 WALL STOPWDWOOD=STLSTEEL=MTLMETAL=AL/GLALUMINUM/GLASS=DOOR SCHEDULEMARKLOCATIONTYPESIZEMATLGLAZINGLOUVERDOORSMATLTYPEGRPHDWLBL/RTGFRAMESREMARKS101ENTRANCEFG--ALAL/GL103OFFICEKITCHEN/DW105108MEN'S TOILET 3'0" x 7'0" x 1 3/4"--MTLWD3'0" x 7'0" x 1 3/4"--107WD1WOMEN'S TOILET1--MTLAL/GL----FFEXISTING DOOR & EXISTING HARDWARE TO REMAIN3'0" x 7'0" x 1 3/4"101AENTRANCEFG--ALAL/GL--AL/GL 3'0" x 7'0" x 1 3/4"EXISTING DOOR & EXISTING HARDWARE TO REMAINEXISTING DOOR & EXISTING HARDWARE TO REMAINF 3'0" x 7'0" x 1 3/4"--WD2MTL3'0" x 7'0" x 1 3/4"C----ALHM--EXISTING DOOR & EXISTING HARDWARE TO REMAIN109JAN CLOSETF 3'0" x 7'0" x 1 3/4"--WD3MTL101BEXIT3'0" x 7'0" x 1 3/4"C----ALHM--DOOR TYPES43" MAX 10" MIN STL. FRAMECAULK (BOTH SIDES -SEE SCHED. DOOR HGT./WIDTH STUD PARTITION2"G.W.B. & MTL.ALL AROUND)BACKBEND RETURNBARRIER-FREE CYLINDRICALLEVER SET DESIGNBARRIER-FREE CYLINDRICALLEVER SET DESIGN08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DOOR & HARDWARE SCHEDULE A-4.1 E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104101101A103107108109101B10501A-602A-603A-604A-607A-6.108A-6.105A-6.106A-6.110A-6.1RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETTHREE COMPARTMENT SINKPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKWALL-MOUNTEDHAND SINKDECK MOUNTWATERSTATIONGLAZERPROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLEDONUT FRYERDONUTDEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEEXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERCONDIMENT BAR17" DEEP COUNTER10'-0"SHIP LAP SIDINGHANDSINKWATERSTATIONBOXSTORAGE10'-0" 11'-93 4"COFFEESTATIONSSHIP LAPSIDINGGRAB-N-GO CASESELF-SERVE U/C CASEDONUTS DISPLAYRACK BY OWNERCOFFEE STATION10'-0"WRAP OPENINGw/STAINLESS STEELFACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLES IN WOODw/ PLASTER & LIME WASHSHIP LAPSIDING2'-10"1'-6"4'-0" 10'-0" 11'-93 4"FACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLESIN WOODw/ PLASTER & LIME WASHSHIP LAP SIDING08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONSSCALE:1/4":1'0"KEY PLANA-5SCALE:1/4":1'0"ELEVATION01SCALE:1/4":1'0"ELEVATION02SCALE:1/4":1'0"ELEVATION03SCALE:1/4":1'0"ELEVATION04 KLINGER'S SHEETRACK SPECSWOOD TOPBAKERS TABLE7'-0"2'-10"10"1'-6"10'-0" 6'-8"SHIP LAPSIDING11'-1014"STAINLESS STEELCLOSURE PANELFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRP2" STAINLESS STEELWRAP AROUNDOPENINGSTAINLESSSTEEL SHELFHANDSINKCONVEYORTOASTER60" REFRIGERATEDCHEF'S BASEGRIDDLEDOUGHNUTFRYER10'-0" 11'-93 4"KITCHEN/PREP/DW105OFFICE103STAINLESS STEELWALL PANELSSHIP LAPSIDINGPROVIDE 14 GA STEELBACKINGDONUT DEPOSITOR MOUNT ARM 38"AFF/7" OFF FRYER'S EDGE; COORDINSTALLATION W/TENANT;PROVIDE STEEL BLOCKINGDOUGHNUTFRYERHANDSINKTHREECOMPARTMENTSINK10'-0"11'-934"FIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPFRPSTAINLESS STEELWALL PANELSFIRE-RATEDTENANTSEPARATION WALLVINYL-FACED ACOUSTICALCEILING TILE & GRIDEXISTING GYP BOARDCEILING; PATCH & REPAIRSTAINLESS STEELCLOSURE PANELEXISTING WOODTRUSSES; FIELDVERIFY DESIGN &LOCATIONSTAINLESS STEELWORK TABLESHELVINGSHEETERPROFFER CABINET10'-0"S/S TABLEWOOD TOPBAKERS TABLESHIP LAPSIDINGVERTICAL ACOUSTICALCEILING FROM 8'-0" TO 12'-0"FOR STORAGE ABOVE W.I.C.AT PERIMETER OF W.I.C.WALK-IN-COOLERFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPDUCTWORK SEAMLESSLYWELDED LIQUIDTIGHT, TYP.HOOD DUCTS - DUCT WRAP EQUALTO 3M FIRE BARRIER DUCT WRAP 615+INSULATION - ZERO CLEARANCE PRODUCT18 GA, #4 WELDED STAINLESS STEELEXHAUST HOOD BY CAPTIVEAIRESTAINLESS STEEL PANEL (80" HIGH) SUPPLIED &INSTALLED BY EQPT. CONTRACTOR TOCOVER PORTIONS OF WALL UNDER THEEXHAUST HOOD.5/8" FIRE-RATED GYP BOARD (TYP X) (EXTENDSTHE FULL LENGTH AND HEIGHT OF THE WALLBEHIND THE HOOD, THE TYPE "x" BOARDS AREFASTENED WITH 2" #12 SCREWS DRYWALLSCREWS. SCREW PATTERN: FASTENERS @ 4"AROUND THE PERIMETER AND 6" IN THE FIELD1/2 " CEMENTITIOUS WALLBOARD (EXTENDS 24"BEYOND THE HOOD ON EACH SIDE). THECEMENT BOARDS ARE FASTENED WITH 2"DUROCK COURSE THREAD #10 SCREWS.SCREW PATTERN: FASTENERS @ 4" AROUNDTHE PERIMETER AND 6" IN THE FIELD20 ga STAINLESS STEEL PLATE (80" HIGH-EXTENDS 18" BEYOND THE HOOD ON EACHSIDE). THE PLATE IS FASTENED TO THE WALLWITH LIQUID NAILSROOF FLASHING, TYP.SUPPLY DUCT:CARBON STEEL NOT LESS THAN 16GAOR STAINLESS STEEL NOT LESS THAN18GADUCT CLEANOUTS AT CHANGE INDIRECTIONS, TYP.STAINLESS STEEL CLOSURE PANELSTAINLESS STEELFILTERS2'-3"1'-9"4'-0"2'-5"08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.1SCALE:1/4":1'0"ELEVATION05SCALE:1/4":1'0"ELEVATION06SCALE:1/4":1'0"ELEVATION07SCALE:1/4":1'0"ELEVATION08SCALE:3/4":1'0"KITCHEN HOOD SECTION09SCALE:1/2":1'0"ADA COUNTER DETAIL SOLID SURFACECOUNTER TOP1'-0"2'-10"4"PROVIDE CONCEALEDMETAL SUPPORTBRACKETS @24" O.C.2X4DOUBLETOP PLATE1'-6"2" STAINLESS STEELWRAP AROUNDOPENING10'-0" 2'-10"SLOPEDSHELVING DONUTDISPLAY RACKCHALKBOARD; FIELD VERIFYDIMENSIONS AND MOUNTINGHEIGHT WITH GC; PROVIDEDBY GCU/C REFw/GLASS DOORS/S STAGINGTABLECOFFEESTATION08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.2SCALE:1 1/2"=1'-0"CUSTOMER COUNTER DETAILSCALE:1/4":1'0"ELEVATION10 1220 Minimum Passage Width for One WheelchairInternational Symbol of Access for Hearing LossWheelchair TransferFig. A6Positions on toilet.Side Approach(b)3Transfers.armrest, sets brakes.Takes transfer position, removes21Diagonal Approach(a)brake.Positions on toilet, releases90 to the toilet).people fold chair or pivot itway, changes position (someMoves wheelchsir out of the43Removes armrest, transfersbrakes.footrest out of the way, setsTakes transfer position, swings2145510551842455455-7601818-301/2 max1/2 maxCane Technique6150150627655 Objects Mounted on Posts or PylonsProtruding Objects (Continued)Fig. 8 (d)Fig. 8Elevationcane range12 max305cane rangethis overhang can begreater than 12 (305)because no one canapproach the objectfrom this directionPlanProtruding ObjectsWalking Perpindicular to a Wall30512 maxFig. 8Fig. 8 (b)cane range1506long dimensionroute of travelperpindicular toGrating OrientationFig. 8 (h)Fig. A436-60 pace915-1525 6150Fig. 302.2Carpet Pile Thickness13GratingsFig. 8 (g)1360 min cane hits post or pytonbefore person hits objectLimits of Protruding ObjectsFig. 307.2preater than 27685 X>80 min.2030higher than 2768568527 max.27 or below685 Lobby4 max.10048122048 max 20 maxclear widthany amount481220XZ30760ElevationDETECTIONFig. 8 (c) freestanding Overhanging ObjectsFig. 307.4 Vertical Clearance AREACANEarea fromcross-trafficprotect shadedPlan2030predominant directionof trafficX<8068527 685 27 max.greater than 12305greater than 1230648 min.UNOBSTRUCTED FORWARD REACH15 min.48 max1220380FIGURE 308.2.148122048122030760 48 min.Lavatory ClearanceFig. 31depthclearancetoe43015017 min.6 max.2058 min.clearanceknee1015 865 735685230 40 max. 34 max.29 min.27 min.9 min.604.1.8.6Clear Floor Space Lavatories122048 min.clearfloorspace19 max.76030 min.48517 min.430door locationapproach only,42 min. latchother approaches81532 min.1004 max.81532 min.4 max.100 alternateClear Floor Space at Water ClosetsFig. 604.360 min.1525clearfloorspace142056 min. 54 min.Front Approach, Pull Side48 min.Front Approach - Sliding DoorsMinimum Clear Floor Space for WheelchairsSpace Requirements for WheelchairSeating Spaces in SeriesFig. 46(b)Side Access167566 min.1525 Additional Maneuvering Clearances for AlcovesFig. 4(e)maneuvering clearance of 12 in (305 mm) shall beNOTE:if x 15 in (380 mm), then an additionalprovided as shown.481220X 30512provided as shown.maneuvering clearance of 6 in (150 mm) shall beNOTE:x 24 in (610 mm), then an additionaland One Ambulatory PersonFig. a148 min. 1220 Forward or Rear Access(a)66 min.1675160760306X NOTE:x 15 in (380 mm.)30 760 601525X>15 Fig. 2Minimum Clear Widthfor Two Wheelchairs60 min.1525NOTE:x 24 in (610 mm).48 1220 76036X>24 34 max.Obstructed High Side Reach Drinking Fountains and Water CoolersFig. 27Fountain or Cooler1220 48 min.built-in(d)76030 min.fountain depthnot to exceed(a) Shelves10 max.535adjustable range 15 min. 380 48 max. 1220 Fig. 308Side ReachFig. 308.3.2865 48 max(c)Fountain or Coolerfreestanding1220 48 min.Clear Floor Space30 min.760610(b)24 max.760 30 min.76030255-610>10-24 MAX1170 46 max 60 min.Unobstructed Side Reach15 mine 380 Fig. 308.3.11220 1370Latch Side Approach - Sliding Doors and Folding DoorsManeuvering Clearances at Doorways Without Doors, and Folding DoorsSlide Side Approach - Sliding Doors1065 42 min.Fig. 404.2.4.2(f)(a)and Folding Doors1220 24 min.61042 min. 1065 (b)Maneuvering Clearances at Manual Swinging Doors and Gates1370 Fig. 404.2.4.1Front Approach, Push Side42 min.1065(d)22 min.56054 min.1065 42 min.18 min.1525 45548 min. 1220 Doors in Series and Gates in Series Fig. 404.2.6desk armWheelchair Turning SpaceFig. 3Fig. 304.3.212 min.91536 min.12 min.1525 60 min. 915 36 min.60-in (1525-mm)-Diameter Space(a)152560 min.1525 60 min.NOTE: Footrest may extend further for tall peopleDimensions of Adult-Sized Wheelchairsaccessible path of travelMinimum Clearances for Seating and TablesMinimum Clear Widthof an Accessible Route91536 min.Fig. 403.5.132 min.815for min. clearance 24 max. depth Forward760(b)3048 1220 Parallel(a)481220760 30 International SymbolsInternational TDD Symbol30760255Clear Floor Space10 max.1506 max.equipment permitted in shaded area122048 min.430-48517-19Knee ClearanceSpout Height and2058 min.307 & 6029 min.430-48517-1936 max. AFF 685 230 27 min. 915 Parallel Approach10 max.25576030(a)7603048 1220 48530760 Fig. 4591519 3648548591519193612204830 760 1220 48 3076048 1220 421065760 30 Fig. 305.348 MIN122036 915 30 76030 760 handlearmrestSignage HeightInternational Symbol of AccessibilityInternational Symbol of AccessibilityDisplay ConditionsFig. 703.7.2.160" MAX. (1525) (measured from the baseline of the highest tactile character)Braille Pictogram710710Maximum Doorway DepthClear Width of Doorways 48 min.1220815(c)Folding Door32 min.Fig. 404.2.3Detail815(b)32 min.Sliding Door24 max.48 min.1220(e)610 Hinged Door81532 min.(a)Fig. A3 (a)78 min.1965Space Needed for Smooth U-turn in a wheelchair32 min.815685 19 485 27 43-51 1090-1295 8 205 18 455 seattoelapLC81532 min.Fig. A260 min. 1525 LC30eye level9 LC30LCLC24712 ra d i u s 1 7 48LC LC246 ra d i u s7173 1 48LC54 max. 1370Fig. 54Tableware Areas36 min.91534 max. 865Fig. 53Food Service Lines1220 48 max.21 max.Fig. 38(b) Closets535Storage Shelves and ClosetsT-Shaped Turning SpacePosition of Clear Floor or Ground SpaceFig. 305.5Forward ApproachFig. 305.7.1Parallel ApproachFig. 305.7.2Maneuvering Clearance in an Alcove 48 1220 (a)Front Approach, Push Side(b)Hinge Approach, Pull Side(e)Hinge Approach, Push Side(f)Sliding Doors, Gates, and Folding Doors22 min.5603805 max12515 minFig. 602.5Drinking Spout Location15 min. 380Fig. 604.7DISPENSER OUTLET LOCATIONWATER CLOSET LOCATIONFig. 604.2405-45516-18CL(a) wheelchairaccessible water closetWATER CLOSET LOCATIONFig. 604.2430-48517-19CL(b) ambulatoryaccessible water closet7-948 max. 1220180-230CL56 min.1420 60 min.1525Wheelchair Accessible Toilet Compartment DoorsFig. 604.8.1.2Size of Clearance at Water ClosetsFig. 604.3.1Wheelchair Accessible Toilet Compartment Toe ClearanceFig. 604.8.1.49 min.230 6 min.150partition12 min.305 6 min.150partition(b)elevationchildren(a)elevationadult(c)plan6 min.150 6 min.15060 min.1525Size of Wheelchair Accessible Toilet CompartmentFig. 604.8.1.1(a)adult wall hungwater closet56 min.1420 60 min.1525(b)adult floor mounted water closetand childern's water closet59 min.1420 60 min.1525Wheelchair Accessible Toilet CompartmentFig. 604.8.1.6in New Construction48" (1220) MAX. (measured from the baseline of the lowest tactile character)Height of Tactile characters above Finish Floor or GroundFig. 703.4.1Fig. 703.7.2.2Fig. 703.7.2.4Volume Telephone ControlFig. 703.7.2.348 min. 122012 minFront Approach, Push Side(c)306door provided with bothcloser and latch36 min60 min915 1525 48 min. 1220 22 min.1065Hinge Approach, Pull Side(g)Latch Approach, Pull Side(h)24 min.106548 min. 1220door provided with bothcloser and latch54 min. 1370 24 min.610Latch Approach, Pull Side(i)door provided with closer24 min.6101065 42 min.Latch Approach, Push Side(j)24 min.6101220 48 min.Latch Approach, Push Side(k)door provided with closerTO REFLECTING SURFACE 1220 510UNOBSTRUCTED FORWARD REACHFIGURE 308.2.148122044 max >20-25 max1120 510-635(a)(b)74 min.FOR REFERENCEONLY; REFER TOFLORIDAACCESSIBILITYCODE 7th EDITION(2020) FOR BUILDINGCONSTRUCTIONURINALSCREENWALL HUNGWALL HUNG13 1/2" min.34513 1/2" min.34517" max.43013 1/2" min.345(a)wall hung type(b)stall typeHeight and Depth of UrinalsFig. 605.23691636 916 36 916481220 back wallCLCLcontrolwallseatwallCLNote: inside finished dimensions measured at the center pointsof opposing sidesTRANSFER TYPE SHOWER COMPARTMENT SIZE AND CLEARANCEFig. 608.118455controlwallseatwallbackwallGRAB BARS FOR TRANSFER TYPE SHOWERSFig. 608.3.1side (control)CLwall48 1220 38 965 15 max455TRANSFER TYPE SHOWER COMPARTMENT CONTROL LOCATIONFig. 608.5.122-23560-585seatwallL-SHAPED SHOWER SEATFig. 610.3.214-15 355-38015-16380-405seatwall1 1/2" max 382 1/2" max64(a)size(b)distance from wallseatwallcompartmententry3" max 75(b)L-shapedEXTENT OF SEATFig. 610.342 min.12 MAX12 min.24 min.305610Rear WallFig. 604.5.233-36 305840-915840-915Side Wall106517-19430-48633-36 36 min.91554 min.1370CLREAR WALL GRAB BAR WATER CLOSETSCONTROLS604.6 - CONTROLS SHALL BE MOUNTED ON THE OPEN SIDE OF THE WATER CLOSET EXCEPT IN AMBULATORY ACCESSIBLECOMPARTMENTS COMPLYING WITH 604.8.2Fig. 604.5.1SIDE WALL GRAB BAR WATER CLOSETSTRANSFER SIDEFINISH FLOORGRIPPING SURFACEFINISH FLOORGRIPPING SURFACE08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 CASCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ACCESSIBILITY GUIDELINES A-6 1.ALL WORK SHALL BE COORDINATED WITH ALL TRADES INVOLVED. OFFSETS IN DUCTS, & TRANSITIONS AROUND OBSTRUCTIONS SHALL BE PROVIDED AT NO ADDITIONAL COST. MAINTAIN MANUFACTURER'S RECOMMENDED CLEARANCES. LOCATION OF DUCTWORK IS APPROXIMATE. PRIOR TO FABRICATING DUCTWORK, CONTRACTOR SHALL VERIFY ALL DIMENSIONS & CLEARANCES AND REPORT ANY DISCREPANCIES BETWEEN DRAWINGS & ACTUAL FIELD CONDITIONS TO THE ENGINEER. PRIOR TO INSTALLING EQUIPMENT, CONTRACTOR SHALL ENSURE EQUIPMENT CLEARANCES WILL BE MAINTAINED. 2.FABRICATE & INSTALL DUCTWORK IN ACCORDANCE WITH SMACNA DUCT CONSTRUCTION STANDARDS, LATEST EDITION. 3.CONDENSATE DISPOSAL SHALL BE IN ACCORDANCE WITH 2020 FMC INCLUDING ALL LATEST REVISIONS. 4.CONDENSATE PIPING SHALL BE TRAPPED AND SIZED PER MANUFACTURER'S RECOMMENDATIONS. 5.INDOOR & OUTDOOR UNITS SHALL HAVE SINGLE POINT OF CONNECTION. 6.PROVIDE CONICAL TAKE-OFFS FOR ALL ROUND TAPS INTO RECTANGULAR DUCTWORK WITH VOLUME DAMPERS AT EACH TAKE-OFF FOR CFM ADJUSTMENT. 7.COORDINATE DIFFUSER BOXES, SUPPLY, & RETURN GRILLES & OTHER MECHANICAL DEVICES WITH LIGHT FIXTURES, SPRINKLER PIPING & PLUMBING. 8.PROVIDE LOW AMBIENT CONTROLS AS NECESSARY TO ALLOW COOLING AT TEMPERATURES DOWN TO 45°F. 9.HORSEPOWER RATINGS ON MOTORS ARE BASED ON SCHEDULED EQUIPMENT & DESIGN CONDITIONS. ACTUAL FIELD CONDITIONS OR SUBSTITUTIONS FROM SCHEDULED EQUIPMENT MAY REQUIRE DIFFERENT HORSEPOWER. IF LARGER MOTOR SIZES ARE REQUIRED OR CHANGES OCCUR IN VOLTAGES, COORDINATE ELECTRICAL SERVICE TO ENSURE PROPER WIRE SIZES & DEVICES AT NO ADDITIONAL COMPENSATION (DUE TO THESE CHANGES) ASKED FOR OR REQUESTED BY ANOTHER CONTRACTOR OR TRADE. 10.REFRIGERANT LINES FROM CU's TO AHU's SHALL BE SIZED PER MANUFACTURER'S RECOMMENDATIONS. 11.ALL FAN MOTORS SHALL HAVE THERMAL OVERLOAD & CURRENT PROTECTION. 12.PROVIDE SMOKE DETECTORS IN SUPPLY DUCT FOR ALL AHU's THAT DELIVER GREATER THAN 2000 CFM OF SUPPLY AIR FOR UNIT SHUTDOWN. CONTRACTOR SHALL PROVIDE AUDIBLE & VISUAL ALARM IN A CONSTANTLY OCCUPIED LOCATION. ALARM SHALL BE LABELED "DUCT TROUBLE". 13.PROVIDE AHU's WITH PROGRAMMABLE THERMOSTATS. 14.PROVIDE UNITS WITH 1" DISPOSABLE FILTER & FILTER HOUSING, TIME DELAY RELAY & LOCKOUT RELAY. 15.PROVIDE UNITS WITH A 5 YEAR WARRANTY FOR COMPRESSORS & ONE YEAR ON OTHER PARTS. 16.ALL DUCTWORK SHALL BE CONSTRUCTED WITH FIBERBOARD OR SHEET METAL PER LATEST SMACNA STANDARDS, & SHALL HAVE A MINIMUM R VALUE OF 6. 17.MECHANICAL CONTRACTOR TO PROVIDE TENANT WITH AIR BALANCE REPORT, EQUIPMENT AND LABOR WARRANTIES AND PROVIDE A COMPLETE, OPERATIONAL MECHANICAL SYSTEM IN COMPLIANCE WITH ALL APPLICABLE CODES. 18.OUTSIDE AIR DUCTS SHALL INCLUDE INSTALLATION OF A MOTORIZED, 2-POSITION DAMPER TO ALLOW THE SCHEDULED AMOUNT OF OUTSIDE AIR TO FLOW THROUGH THE UNIT, AND CLOSE UPON UNIT SHUTDOWN. 19.ALL WORK SHALL BE PERFORMED IN ACCORDANCE WITH THE 2020 FLORIDA MECHANICAL CODE (INCLUDING ALL LATEST REVISIONS), NFPA 90A, ASHRAE 62.1-2016, AND ASHRAE 90.1. 20.PROVIDE ENGINEER OF RECORD WITH HVAC EQUIPMENT CUT SHEETS. CUT SHEETS SHALL BE APPROVED PRIOR TO INSTALLATION. 21.THE MECHANICAL CONTRACTOR SHALL VISIT THE SITE PRIOR TO SUBMITTING A BID FOR THE PROJECT. THE MECHANICAL CONTRACTOR SHALL COORDINATE DUCTWORK LOCATIONS DESIGNED BY THE MECHANICAL ENGINEER AND FIELD VERIFY ANY OBSTACLES OR CONFLICTS AND NOTE THEM IMMEDIATELY TO THE ENGINEER. NO DUCTWORK SHALL BE FABRICATED PRIOR TO FIELD VERIFYING ALL EXISTING CONDITIONS. NOTE: SOME SYMBOLS SHOWN DO NOT PERTAIN TO THIS PROJECT THERMOSTAT/SENSOR SUPPLY AIRFLOW RETURN/ EXHAUST AIRFLOW DEHUMIDISTAT AIR DEVICE TYPE CFM AMOUNT SMOKE DETECTOR DUCT TEMPERATURE SENSOR CEILING RETURN AIR GRILLE CEILING EXHAUST AIR GRILLE MANUAL VOLUME DAMPER FLEX DUCT (INSIDE DIMENSION) NEW ROUND DUCT (INSIDE DIMENSION) EXISTING DUCT TO REMAIN EXISTING DUCT TO BE REMOVED CONNECT NEW DUCT TO EXISTING DUCT TRUNCATE DUCT - LIMIT OF DEMOLITION VANED ELBOW RADIUS ELBOW TRANSITION - CONCENTRIC TRANSITION - ECCENTRIC SQUARE TEE SUPPLY DUCT (UP & DOWN) RETURN DUCT (UP & DOWN) EXHAUST DUCT (UP & DOWN) ROUND DUCT (UP & DOWN) STANDARD BRANCH TAKE-OFF DUCT / WALL MOUNTED SUPPLY REGISTER / GRILLE DUCT / WALL MOUNTED RETURN/ EXHAUST REGISTER / GRILLE MECHANICAL GENERAL NOTES SYMBOL LEGEND ABBREVIATIONS CEILING SUPPLY AIR DIFFUSERNEW RECTANGULAR DUCT (INSIDE DIMENSIONS; WIDTH X DEPTH) ABV ABOVE AFF ABOVE FINISH FLOOR AHU AIR HANDLING UNIT BDD BACKDRAFT DAMPER BHP BRAKE HORSEPOWER BTU BRITISH THERMAL UNIT CFM CUBIC FEET PER MINUTE CIRC CIRCULAR CU CONDENSING UNIT DCI DUCTLESS CEILING-CASSETTE INDOOR DCO DUCTLESS CEILING-CASSETTE OUTDOOR DN DOWN DWI DUCTLESS WALL-MOUNTED INDOOR DWO DUCTLESS WALL-MOUNTED OUTDOOR EAT ENTERING AIR TEMPERATURE EDB ENTERING DRY-BULB (TEMPERATURE) EER ENERGY EFFICIENCY RATIO EF EXHAUST FAN ESP EXTERNAL STATIC PRESSURE EWB ENTERING WET-BULB (TEMPERATURE) EX EXISTING FD FIRE DAMPER FF FLY FAN (AIR CURTAIN) FLA FULL LOAD AMPS FPM FEET PER MINUTE FT FEET GPM GALLON PER MINUTE HE HEATER HP HEAT PUMP HP HORSEPOWER HUM HUMIDIFIER IN INCHES IRH INFRARED HEATERS KEF KITCHEN EXHAUST FAN KW KILOWATT L LOUVER LAT LEAVING AIR TEMPERATURE MBH THOUSANDS BTUs PER HOUR MCA MINIMUM CIRCUIT AMPS MOCP MAXIMUM OVER CURRENT PROTECTION MOD MOTOR OPERATED CONTROL DAMPER MUA MAKE-UP AIR UNIT NA NOT APPLICABLE NC NOISE CRITERIA NC NORMALLY CLOSED NO NORMALLY OPEN NTS NOT TO SCALE OA OUTSIDE AIR OD OUTSIDE DIAMETER PSI POUNDS PER SQUARE INCH RA RETURN AIR RECT RECTANGULAR RH RELATIVE HUMIDITY RLA RUN LOAD AMPERE RTU ROOFTOP AIR HANDLING UNIT RPM REVOLUTION PER MINUTE SA SUPPLY AIR SEER SEASONAL ENERGY EFFICIENCY RATIO SF SUPPLY FAN SS STAINLESS STEEL SP STATIC PRESSURE TYP TYPICAL UC UNDERCUT DOOR UNO UNLESS NOTED OTHERWISE UTR UP THROUGH ROOF V/PH VOLTS/PHASE VCD VOLUME CONTROL DAMPER VAV VARIABLE AIR VOLUME VD VOLUME DAMPER (MANUAL OPPOSED BLADE) VFD VARIABLE FREQUENCY DRIVE W WATTS WEF WALL EXHAUST FAN HEATER SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL NOTES, LEGEND AND ABBREVIATIONSM-1 LOUVER SCHEDULE MARK DESCRIPTION TOTAL AIR (CFM)MOUNTING FACE SIZE MATERIAL BASIS OF DESIGN NOTES L-1 OUTDOOR AIR INTAKE 425 WALL MOUNTED 20" x 14"ALUMINUM GREENHECK EVH-501D 1,2 L-2 OUTDOOR AIR INTAKE 425 WALL MOUNTED 20" x 14"ALUMINUM GREENHECK EVH-501D 1,2 NOTES: 1. MATCH LOUVER COLOR AND FINISH TO EXTERIOR OF BUILDING. 2. PROVIDE BIRD SCREEN AND MOTORIZED, 2-POSITION O/A DAMPER. BRANCH & FLEX DUCT SCHEDULE 0 - 160 CFM -6"Ø 165 - 250 CFM -8"Ø 255 - 380 CFM -10"Ø 385 - 470 CFM -12"Ø 475 - 700 CFM -14"Ø 705 - 1100 CFM -16"Ø NOTE : BRANCH RUNOUT SIZE REFLECTS SUPPLY DIFFUSER NECK SIZE UNLESS OTHERWISE NOTED. SPLIT SYSTEM COOLING UNIT SCHEDULE MARK INDOOR FAN DATA COOLING CAPACITY SEER INDOOR FAN OUTDOOR FAN ELECTRICAL DATA BASIS OF DESIGNTOTAL FLOW (CFM) 0/A (CFM) ESP (W.G.) MOTOR (HP) EDB (°F) EWB (°F) AMBIENT (°F) TOTAL (BTU/HR) SENSIBLE (BTU/HR) MCA (A) MOCP (A) HEATER (kW) MCA (A) MOCP (A)VOLTS Hz PHASE AHU-1 /CU-1 1850 425 0.5 --80 67 95 56,200 40,600 14.5 36.4 40 8.8 21.2 35 208 60 3 YORK AVC60DX21 / TCD60B31S AHU-2 /CU-2 1850 425 0.5 --80 67 95 56,200 40,600 14.5 36.4 40 8.8 21.2 35 208 60 3 YORK AVC60DX21 / TCD60B31S NOTES: 1. UNITS PROVIDED SHALL MEET ALL SCHEDULED VALUES REGARDLESS OF MODEL OR TYPE, UNLESS APPROVED BY THE ENGINEER. 2. PROVIDE EACH UNIT WITH A PROGRAMMABLE THERMOSTAT MOUNTED @ 48" AFF. 3. PROVIDE WATER-LEVEL DETECTION DEVICE INSIDE PRIMARY DRAIN PAN THAT WILL SHUT OFF UNIT WHEN THE PRIMARY DRAIN PAN BECOMES RESTRICTED. 4. PROVIDE MOTORIZED O/A DAMPER SET WITH TIMECLOCK TO CLOSE DURING UNOCCUPIED TIMES 5. CONDENSING UNITS ON ROOF WITH LANDLORD APPROVED CONDENSING STANDS. EXHAUST FAN / MAKE-UP AIR SCHEDULE MARK SERVICE TOTAL AIR (CFM) E.S.P. (W.G)UNIT TYPE DRIVE POWER (W)FLA VOLTS/PH/HZ MANUFACTURER MODEL NUMBER NOTES EF-1,2 TOILET ROOM 70 0.13 CEILING DIRECT 15 0.27 115/1/60 GREENHECK SP-A70 1,2 KEF-1 KITCHEN 3035 1.5 ROOF DIRECT --7.5 230/3/60 CAPTIVE AIRE EADU180H 3,4,5 MUA-1 KITCHEN 2428 0.5 ROOF DIRECT --3.4 230/3/60 CAPTIVE AIRE EA-A2-20D 3,4 NOTES: 1. INTERLOCK WITH LIGHT SWITCH. 2. PROVIDE BACKDRAFT DAMPER. 3. INTERLOCK WITH HOOD. 4. PROVIDE DISCONNECT. 5. PROVIDE VENTED HINGE CURB. AIR DISTRIBUTION DEVICE SCHEDULE MARK DESCRIPTION MOUNTING FACE SIZE BASIS OF DESIGN NOTES A 4-WAY SUPPLY LAY-IN 24"x 24" / 12"x 12" / 12"x 6"TITUS TMS 1,2 B EGGCRATE RETURN LAY-IN 24"x 24" / 12"x 12"TITUS 50F 2 C 2-WAY SUPPLY DUCT 12" x 6"TITUS 300FS 1,2 D RETURN REGISTER DUCT 22" x 22"TITUS 355FS 1,2 E PERFORATED DIFFUSER LAY-IN 24"x 24"TITUS PCS 1,2 NOTES: 1. LOUVER FACE. 2. WITH OPTIONAL DAMPER. MUA CONDENSING UNITS MARK COOLING CAPACITY ELECTRICAL DATA BASIS OF DESIGN NOTES TOTAL TONS SEER MOCP MCA VOLTS HZ PHASE CU-3 5 14 30 21.5 208/230 60 3 A2-20D-MPU -SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL SCHEDULESM-2 E1UTILITYCABINET.EF-2 EF-1 A 225 A 225 A 50 A 50 A 50 A 100 AHU-1AHU-2E 350 E 350 E 350 A 100 A 275 B 700 B 725 E 275 WALLCAP L-2 425 L-1 425 B 650 B 675 A 250 A 275 A 275 A 250 A 250 B 100 KEF-118"x16"8"x10"12"x12"10"x10"16"x14"12"x10" 6"x8" 18"x16"20"x18"6"Ø8"Ø6"x8"8"x8" CU-2 CU-1 MUA-16"x8"18"x18"MUA 809 MUA 809 MUA 810 12"x10"12"x10"MM20"x18"20"x16" 16"x16" 18"x16" 14"x14" ON ROOF ON ROOF WALK-IN-COOLER 106 JAN CLOSET 109 MEN'S ROOM 108 WOMEN'S ROOM 107 KITCHEN/ PREP/DW 105 ORDER COUNTER 102 SEATING AREA 101 OFFICE 103 CONDIMENT AREA 104 CU-3SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL PLANSCALE:3/8"=1'-0" MECHANICAL PLAN M-3 SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD 08-23-22370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATEISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7MECHANICAL DETAILSM-4 SCALE:N.T.S. DUCT HANGER DETAIL SCALE:N.T.S. RADIUS ELBOW - RECT. DUCT SCALE:N.T.S. ELBOW DETAIL - RECT. DUCT SCALE:N.T.S. FLEX DUCT CONNECTION DETAIL SCALE:N.T.S. TOILET EXHAUST DETAIL SCALE:N.T.S. DUCT OFFSET SCALE:N.T.S. TYPICAL BRANCH TAKE-OFF DETAIL SCALE:N.T.S. AHU CONNECTION DETAIL Jacksonville Office REGION 65 PHONE: (904) 463-6242 EMAIL: reg65@captiveaire.com FOR QUESTIONS, CALL THE 1 5424 ND-2-PSP-F CAPTIVEAIRE 12' 11"600 DEG I HEAVY 235 3035 4"18"3035 1717 -1.298"2428 430 SS WHERE EXPOSED ALONE ALONE HOOD NO TAG MODEL MANUFACTURER LENGTH MAX COOKING TEMP TYPE APPLIANCE DUTY DESIGN CFM/FT TOTAL EXH CFM EXHAUST PLENUM RISER(S) WIDTH LENG HEIGHT DIA CFM VEL SP TOTAL SUPPLY CFM HOOD CONSTRUCTION HOOD CONFIG END TO END ROW 1 CAPTRATE SOLO FILTER 9 16"16"85% SEE FILTER SPEC 4 RECESSED ROUND NO LEFT 12"x54"x24"TANK FS 4.0/4.0 DCV-1111 1 LIGHT 1 FAN YES 1050 LBS HOOD NO TAG FILTER(S) TYPE QTY HEIGHT LENGTH EFFICIENCY @ 7 MICRONS LIGHT(S) QTY TYPE WIRE GUARD UTILITY CABINET(S) LOCATION SIZE FIRE SYSTEM TYPE SIZE ELECTRICAL MODEL # SWITCHES QUANTITY FIRE SYSTEM PIPING HOOD HANGING WEIGHT 1 FIELD WRAPPER 18.00" HIGH FRONT, LEFT, RIGHT. BACKSPLASH 80.00" HIGH X 168.00" LONG 430 SS VERTICAL. RIGHT SIDESPLASH 80.00" HIGH X 54.00" LONG 430 SS VERTICAL. RIGHT END STANDOFF (FINISHED) 1" WIDE 54" LONG INSULATED. LEFT QUARTER END PANEL 23" TOP WIDTH, 0" BOTTOM WIDTH, 23" HIGH 430 SS. RIGHT WALL AS END PANEL. HOOD NO TAG OPTION 1 Front 168"16"6" MUA MUA MUA 12" 12" 12" 28" 28" 28" 809 809 809 0.210" 0.210" 0.210" HOOD NO TAG POS LENGTH WIDTH HEIGHT TYPE RISER(S) WIDTH LENG DIA CFM SP PATENT NUMBERS AC-PSP WALL (CANADA) - CA PATENT 2820509. AC-PSP (UNITED STATES) - US PATENT 7963830 B2. AC-PSP ISLAND (CANADA) - CA PATENT 2520330. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 322331500500 FLOW RATE (CFM) 1000 0.00 0 0.50PRESSURE DROP (in. H20)PRESSURE DROP VS. FLOW RATE RRSPECIFICATION: CAPTRATE GREASE-STOP SOLO FILTER A UNIQUE S-BAFFLE DESIGN IN CONJUNCTION WITH A SLOTTED REAR BAFFLE DESIGN, THE CAPTRATE GREASE-STOP SOLO FILTER IS A SINGLE-STAGE FILTER FEATURING LARGER, WITH A CORRESPONDING PRESSURE DROP NOT TO EXCEED 1.0 INCHES OF WATER GAUGE. FILTER IS STAINLESS STEEL CONSTRUCTION, AND SIZED TO FIT INTO STANDARD GREASE EXTRACTION EFFICIENCY PERFORMANCE SHALL REMOVE AT LEAST 75% OF GREASE PARTICLES FIVE MICRONS IN SIZE, AND 85% GREASE PARTICLES SEVEN MICRONS IN SIZE AND COMPONENTS WHEN ASSEMBLED. 2-INCH DEEP HOOD CHANNEL(S). TO DELIVER EXCEPTIONAL FILTRATION EFFICIENCY. UNITS SHALL INCLUDE STAINLESS STEEL HANDLES AND A FASTENING DEVICE TO SECURE THE TWO FRACTIONAL EFFICIENCY (%)0 0.1 20 40 1.0 PARTICLE DIAMETER (UM) 10.0 EFFICIENCY VS. PARTICLE DIAMETER 60 80 100 THE CAPTRATE GREASE-STOP SOLO WAS TESTED TO ASTM STANDARD ASTM F2519-05.TE ANSF ACCORDANCE No. 96 NFPA WITH BUILT IN SLI DTE RO C H B N RAN I,OR M .YRO RLAIGNTSB ATCAPTRATE FILTERS ARE BUILT IN COMPLIANCE WITH:. NFPA #96. NSF STANDARD #2. UL STANDARD #1046. INT. MECH. CODE (IMC). ULC-S649. 1.00 1.50 2.00 2.50 3.00 3.50 MANUFACTURER APPROVED FOR USE IN SOLID FUEL APPLICATIONS AS A SPARK ARRESTER. GREASE DUCT & CHIMNEY SPECIFICATIONS: PROVIDE GREASE DUCT EQUAL TO ECON-AIR MODEL "EDW" ROUND 20 GAUGE 430 STAINLESS STEEL DUCTWORK. MODEL "EDW" IS LISTED TO UL-1978 AND IS INSTALLED USING "V" CLAMP LOCKING CONNECTIONS SEALED WITH 3M FIRE BARRIER 2000 PLUS. MODEL "EDW" DOES NOT REQUIRE WELDING PROVIDING IT HAS BEEN INSTALLED PER THE MANUFACTURES INSTALLATION GUIDE. PROVIDE RATED ACCESS DOORS AT EVERY CHANGE IN DIRECTION AND EVERY 12' ON CENTER. PER MANUFACTURES LISTING MODEL "EDW" HORIZONTAL RUNS LESS THAN 75 FT. CAN BE SLOPED 1/16" PER 12", HORIZONTAL RUNS MORE THAN 75 FT. CAN BE SLOPED 3/16" PER 12". DUCT SHOULD BE SLOPED AS MUCH AS POSSIBLE TO REDUCE THE CHANCE OF GREASE ACCUMULATION IN HORIZONTAL RUNS. IF THE DUCT OR CHIMNEY IS WITHIN 18 INCHES OF COMBUSTIBLE MATERIAL, PROVIDE UL-2221 OR UL-103 HT LISTED DOUBLE WALL GREASE DUCT OR DOUBLE WALL CHIMNEY EQUAL TO ECON-AIR MODEL "EDW- 2R, 2R TYPE HT, 3R, OR 3Z" ROUND 20 GAUGE 430 STAINLESS INNER DUCT INSULATED WITH A 24 GAUGE 430 STAINLESS OUTER SHELL. § ECON-AIR RECOMMENDS THE USE OF LISTED, PRE-FABRICATED ROUND GREASE EXHAUST DUCT TO REDUCE STATIC PRESSURE IN THE SYSTEM, MINIMIZE INSTALLATION AND INSPECTION TIMES, AND ENSURE DUCT IS LIQUID TIGHT CUSTOMER APPROVAL TO MANUFACTURE: ___' - ___" VERIFY CEILING HEIGHT HVAC DISTRIBUTION NOTE HIGH VELOCITY DIFFUSERS OR HVAC RETURNS SHOULD NOT BE PLACED WITHIN TEN (10) FEET OF THE EXHAUST HOOD. PERFORATED DIFFUSERS ARE RECOMMENDED. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL ALL-THREAD. HOOD CORNER HANGING ANGLE (WEIGHT BEARING ANCHOR POINT FOR HOOD). HOOD CORNER HANGING ANGLE 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. ASSEMBLY INSTRUCTIONS HANGING ANGLE MUST BE SUPPORTED WITH 1/2" - 13 TPI GRADE 5 (MINIMUM) ALL-THREAD. SANDWICH HANGING ANGLES AND CEILING ANCHOR POINTS WITH 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHERS AND 1/2" - 13 TPI GRADE 5 (MINIMUM) HEX NUTS AS SHOWN. MUST USE DOUBLED HEX NUT CONFIGURATION BENEATH HOOD HANGING ANGLES AND ABOVE CEILING ANCHORS. MAINTAIN 1/4" OF EXPOSED THREADS BENEATH BOTTOM HEX NUT. TORQUE ALL HEX NUTS TO 57 FT-LBS. (HARDWARE BY INSTALLER) 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. SUPPLY PLENUM HANGING ANGLE (WEIGHT BEARING ANCHOR POINT FOR SUPPLY PLENUM). SUPPLY PLENUM HANGING ANGLE 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL ALL-THREAD. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUTS. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. 1/2" - 13 TPI GRADE 5 (MINIMUM) STEEL HEX NUT. 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHER. ASSEMBLY INSTRUCTIONS HANGING ANGLE MUST BE SUPPORTED WITH 1/2" - 13 TPI GRADE 5 (MINIMUM) ALL-THREAD. SANDWICH HANGING ANGLES AND CEILING ANCHOR POINTS WITH 1/2" GRADE 5 (MINIMUM) STEEL FLAT WASHERS AND 1/2" - 13 TPI GRADE 5 (MINIMUM) HEX NUTS AS SHOWN. MUST USE DOUBLED HEX NUT CONFIGURATION ABOVE CEILING ANCHORS. SINGLE HEX NUT BENEATH HANGING ANGLE IS ACCEPTABLE FOR PSP HANGING ANGLES. MAINTAIN 1/4" OF EXPOSED THREADS BENEATH BOTTOM HEX NUT. TORQUE ALL HEX NUTS TO 57 FT-LBS. (HARDWARE BY INSTALLER) SYSTEM DESIGN VERIFICATION (SDV) IF ORDERED, CAS SERVICE WILL PERFORM A SYSTEM DESIGN VERIFICATION (SDV) ONCE ALL EQUIPMENT HAS HAD A COMPLETE START UP PER THE OPERATION AND INSTALLATION MANUAL. TYPICALLY, THE SDV WILL BE PERFORMED AFTER ALL INSPECTIONS ARE COMPLETE. ANY FIELD RELATED DISCREPANCIES THAT ARE DISCOVERED DURING THE SDV WILL BE BROUGHT TO THE ATTENTION OF THE GENERAL CONTRACTOR AND CORRESPONDING TRADES ON SITE. THESE ISSUES WILL BE DOCUMENTED AND FORWARDED TO THE APPROPRIATE SALES OFFICE. IF CAS SERVICE HAS TO RESOLVE A DISCREPANCY THAT IS A FIELD ISSUE, THE GENERAL CONTRACTOR WILL BE NOTIFIED AND BILLED FOR THE WORK. SHOULD A RETURN TRIP BE REQUIRED DUE TO ANY FIELD RELATED DISCREPANCY THAT CANNOT BE RESOLVED DURING THE SDV, THERE WILL BE ADDITIONAL TRIP CHARGES. DURING THE SDV, CAS SERVICE WILL ADDRESS ANY DISCREPANCY THAT IS THE FAULT OF THE MANUFACTURER. SHOULD A RETURN TRIP BE REQUIRED, THE GENERAL CONTRACTOR AND APPROPRIATE SALES OFFICE WILL BE NOTIFIED. THERE WILL BE NO ADDITIONAL CHARGES FOR MANUFACTURER DISCREPANCIES. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-4 12' 11"NOM./12' 11.00"OD. 14'-0.00" OVERALL LENGTH 54" 12" UTILITY CABINET. 16" 28" 8" 12" 28" 56" 8" 12" 28" 56" 8" 12" 28" 1" LAYER OF INSULATION FACTORY INSTALLED IN 1.00" END STANDOFF MEETS 0" REQUIREMENTS CLEARANCE TO COMBUSTIBLE SURFACES. 1" 3" § 77 1/2"77 1/2" 12" Ø18" U.L. LISTED RECESSED ROUND LED FIXTURE AND LED LIGHT. INSTALLER MUST CONFIRM HOOD IS INSTALLED SUCH THAT THE SPECIFIED WALL, ACTING AS AN END PANEL, IS MATED TIGHT TO THE CORRECT END OF HOOD TO ACHIEVE A REDUCED MINIMUM EXHAUST CFM LISTING. NON-COMPLIANCE WILL NULLIFY THE ETL LISTING, VOID THE MANUFACTURER'S WARRANTY, AND HOLD THE CONTRACTOR LIABLE FOR ANY AND ALL LOSSES, COSTS, AND EXPENSES RELATED TO THE NON-CONFORMANCE OF THE MANUFACTURER'S SPECIFIED INSTRUCTION. THE WALL ACTING AS AN END PANEL MUST EXTEND NO LESS THAN 20" FROM THE INTERSECTING WALL ON WHICH HOOD IS MOUNTED AND MUST EXTEND NO LESS THAN 20" UNDER BOTTOM OF HOOD TO BE ELIGIBLE FOR REDUCED MINIMUM EXHAUST CFM LISTING. NOTE: ADDITIONAL HANGING ANGLES PROVIDED FOR HOODS 12' AND LONGER. 3" INTERNAL STANDOFF. GREASE DRAIN WITH REMOVABLE CUP. SEE HOOD TABLE. §EXHAUST RISER. HANGING ANGLE. RECESSED ROUND LED FIXTURE AND LED LIGHT, 3500 K WARM OUTPUT. 23.5% OPEN STAINLESS STEEL PERFORATED PANEL. ATTACHING PLATES. SUPPLY RISER WITH VOLUME DAMPER. 6" 2 3/4" 16" 18" BACKSPLASH 80.00" HIGH X 168.00" LONG. FIELD WRAPPER 18.00" HIGH (SEE HOOD OPTIONS TABLE). RIGHT WALL AS END PANEL. 23" 23" LEFT QUARTER END PANEL. EQUIPMENT BY OTHERS. 48.0" MAX. 80" 24" NOM. 54" IT IS THE RESPONSIBILITY OF THE ARCHITECT/OWNER TO ENSURE THAT THE HOOD CLEARANCE FROM LIMITED-COMBUSTIBLE AND COMBUSTIBLE MATERIALS IS IN COMPLIANCE WITH LOCAL CODE REQUIREMENTS. 16" CAPTRATE SOLO FILTER WITH HOOK. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-5 SECTION 23 38 13 13 SPECIFICATIONS TAG: Commercial Kitchen Ventilation Hoods, Listed Commercial Kitchen Hoods PART 1 - GENERAL 1.1 SUMMARY A. The ND2 series is a Type I, wall canopy hood for use over 600°F cooking surface temperatures. The aerodynamic design includes a mechanical baffle and performance enhancing lip for exceptional capture and containment. B. The hood shall have the size, shape, and performance specified on drawings. 1.2 SUBMITTALS A. The manufacturer assumes no liability for the use or results of use from this document. Specifications are to be reviewed by the engineer to confirm the project’s requirements and meet Federal, State, and Local codes and regulations. B. As the manufacturer continues product development, it reserves the right to change design and specifications without notice. C. The manufacturer shall supply complete computer generated submittal drawings, including hood section view(s) and hood plan view(s). These drawings must be available to the engineer, architect, and owner for their use in construction, operation, and maintenance. 1.3 QUALITY ASSURANCE A. This hood is ETL-listed to standard UL710, ULC710, and ULC-S646 when installed in accordance with these installation instructions and National Fire Protection Association Standard “NFPA 96, Standard for Ventilation Control and Fire Protection of Commercial Cooking Operations.” B. Built-in compliance with NSF/ANSI Standard 2. C. The hood shall be ETL Listed as: 1. “Exhaust Hood Without Exhaust Damper.” 2. ETL Sanitation Listed and built in accordance with NFPA 96. 3. The ETL label shall list temperature rating(s) and minimum CFM/ft rating(s). 1.4 WARRANTY A. All units shall be provided with the following standard warranty: 1. This equipment is warranted to be free from defects in materials and workmanship, under normal use and service, for a period of 2-years from date of shipment. B. The manufacturer shall not be liable for incidental and consequential losses and damages potentially attributable to malfunctioning equipment. Should any part of the equipment prove to be defective in material or workmanship within the 2-year warranty period, upon examination by the manufacturer, such part will be repaired or replaced by manufacturer at no charge. The buyer shall pay all labor costs incurred in connection with such repair or replacement. Equipment shall not be returned without manufacturer’s prior authorization, and all returned equipment shall be shipped by the buyer, freight prepaid to a destination determined by the manufacturer. C. Refer to Manufacturer’s Operation, Installation, and Maintenance (OIM) Manual for detailed descriptions of what is/is not covered and contact information for warranty claims. PART 2 - PRODUCTS 2.1 GENERAL A. Construction shall be dependent on the structural application to minimize distortion and other defects. All seams, joints, and penetrations of the hood enclosure to the lower outermost perimeter, which directs and captures grease-laden vapor and exhaust gases, shall have a liquid-tight continuous external weld in accordance with NFPA 96. B. Duct sizes, CFM, and static pressure requirements shall be as shown on drawings. Static pressure requirements shall be precise and accurate; air velocity and volume information shall be accurate within 1-ft increments along the length of the ventilator. 2.2 CONSTRUCTION A. Construction shall be type 430 stainless steel. B. Double wall insulated front to eliminate condensation and increase rigidity on wide sizes. The insulation shall have a flexural modulus of 475 EI, meet UL 181 requirements and be in accordance with NFPA 90A and 90B. C. Hood shall be equipped with a minimum of four connections for hanger rods. Hood lengths greater than 12’ will have added hangers. D. Exhaust duct collar to be 4” high with flange. E. The grease drain system shall be an enclosed integral part of the hood back and have slopes with an exposed, removable 1/2 grease cup to facilitate cleaning. F. An integral baffle to direct grease laden vapors toward the exhaust filter bank. G. Hood shall be furnished with UL classified filters, supplied in size and quantity as required by ventilator. H. All seams shall be welded and have stainless steel on exposed surfaces. 2.3 LIGHTING A. Recessed round LED fixture and LED light, 3500K Warm output. 2.4 FILTERS A. Stainless Steel Captrate Solo filter with hook, ETL Listed. Particulate capture efficiency: 85% efficient at 9 microns, 76% efficient at 5 microns. 2.5 OPTIONS A. Fire Suppression System: UL 300 fire suppression system. B. Optional perforated supply plenum shall provide make-up air discharged below the cooking equipment. 1. Perforated diffuser plates shall be included in the design to provide even air distribution. 2. Unexposed surfaces shall be constructed of aluminized steel. Plenum shall be insulated to prevent condensation. 3. Perforated Supply Plenum (PSP) C. Hood Mounted Utility Cabinet - Cabinet can store listed fire suppression system, listed components, pre-wired electrical controls. 2.6 ACCESSORIES A. End Panel(s) maximize hood performance and eliminate the effects of cross drafts in the kitchen. Units constructed of stainless steel and sized according to hood width and cooking equipment. Exposed edges hemmed for safety and rigidity. Selected panels: 1. Quarter End Panel 2. Wall as End Panel B. Splash panel(s) selected: 1. Backsplash 2. Right Sidesplash C. Standoff(s) selected: 1. Right End Standoff D. Wrapper(s) may be installed from the factory or field installed. Wrapper(s) selected: 1. Wrapper PART 3 - EXECUTION 3.1 EXAMINATION A. Examine areas and conditions under which the system is installed. Do not proceed with work until unsatisfactory conditions have been corrected in a manner acceptable to Installer. 3.2 INSTALLATION A. Install in accordance with manufacturer's instructions, drawings, written specifications, manufacturer’s installation manual, and all applicable building codes. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-6 1 TANK FS 4.0/4.0 37 FIRE CABINET LEFT LEFT, HOOD 1 FIRE SYSTEM NO TAG TYPE SIZE FLOW POINTS INSTALLATION SYSTEM LOCATION ON HOOD 1 SC ELECTRICAL 0.750 CAPTIVEAIRE SYSTEMS FIRE SYSTEM NO TAG TYPE SIZE SUPPLIED BY FACTORY PIPING EXTENDS A MAXIMUM OF 6" ABOVE THE TOP OF THE HOOD. 12" Ø18" HOOD FRONT HOOD BACK HOOD # 1 JOB # 5577674 FS # 1 MODEL: ND-2-PSP-F SIZE: 54"x24" LENGTH: 12' 11"TANK OVERLAPPING PROTECTION- 30HIGH PROXIMITY132.00" L X30.00" DDUCT S 360 OL-F OL-F OL-F 25.0000 21.50" OL-F 21.50" OL-F 21.50" OL-F 21.50" OL-F 21.50" OL-F NOZZLE HEIGHT 35-50" FROM COOKING SURFACE. (45.2500) 35.0000 27.0000 27.0000 27.0000 27.0000 12.0000 - SYSTEM REQUIRES A MINIMUM OF 7 FT OF EQUIVALENT PIPE LENGTH BETWEEN TANK AND NEAREST APPLIANCE NOZZLE FOR MOST APPLIANCES. EACH 90 DEGREE ELBOW ADDS 1.3 FT OF EQUIVALENT LENGTH. SEE MANUAL FOR DETAILS 7 1 631 2 5 PLENUMPLENUMNOTES - FIELD PIPE DROPS AS SHOWN PIPING, ELBOWS, TEES, AND NOZZLES SUPPLIED BY CAS. - FIELD INSTALLED DROP: FACTORY WILL PROVIDE QTY 2 60IN LONG PIECES OF CHROME PLATED PIPING SHIPPED LOOSE TO BE FIELD-INSTALLED. - SHIP LOOSE DROP: FACTORY WILL PROVIDE THE EXACT CHROME PIPE LENGTH NEEDED SHIPPED LOOSE TO BE FIELD-INSTALLED. - RELOCATE NOZZLES IF FLOW PATTERN IS BLOCKED BY SHELVING, SALAMANDERS, ETC. - OVERLAPPING COVERAGE SHALL NOT BE USED ON ANY APPLIANCE WITH AN OBSTRUCTION. - IF APPLICABLE, EXTENDED PRE-PIPED DROPS ARE SHIPPED LOOSE. - FACTORY PIPING EXTENDS A MAXIMUM OF 6" ABOVE THE TOP OF THE HOOD. - APPLIANCE DIMENSIONS LISTED REPRESENT THE COOKING SURFACE SIZE, NOT THE OVERALL APPLIANCE SIZE. - THIS FIRE SYSTEM COMPLIES WITH U.L. 300 REQUIREMENTS. - OL-F NOZZLE PART NUMBER REPLACES 3070-3/8H-10-SS JOB #: 5577674. JOB NAME: ISLAND DONUTS. SYSTEM SIZE: TANK-SP-2 TOTAL FP REQUIRED: 37. HOOD # 1 12' 11.00" LONG x 54" WIDE x 24" HIGH. RISER # 1 SIZE: 18" DIA. HOOD # 1 METAL BLOW-OFF CAPS INCLUDED. - HEAVY-DUTY APPLIANCES (RATED 600°F) WILL REQUIRE AN ADDITIONAL DOWNSTREAM FIRESTAT IN THE EVENT THAT THE DUCTWORK CONTAINS ANY HORIZONTAL RUNS OVER 25 FT IN LENGTH. - MEDIUM TO LIGHT-DUTY APPLIANCES (RATED 450°F) WILL NOT REQUIRE ANY ADDITIONAL DOWNSTREAM DETECTION. PRESSURE SUPERVISION SWITCH. PRIMARY ACTUATOR RELEASE. 4 GALLON TANK. 7 6 5 4 2 1 PRIMARY HOSE ASSEMBLY. SECONDARY ACTUATOR RELEASE.3 SECONDARY HOSE ASSEMBLY. REMOTE MANUAL ACTUATION DEVICE. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 322333/4" VALVE SHOWN FOR REFERENCE. CONFIRM WITH PLUMBER REQUIRED VALVE SIZE. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-7 SECTION 21 23 00 WET- CHEMICAL FIRE-EXTINGUISHING SYSTEMS TAG: TANK Fire Suppression PART 1 - GENERAL 1.1 SUMMARY A. TANK Fire Suppression is a pre-engineered, stored-pressure wet chemical solution extinguishing system. 1.2 SUBMITTALS A. The manufacturer assumes no liability for the use or results of use from this document. Specifications are to be reviewed by the engineer to confirm the requirements of the project and meet Federal, State, and Local codes. B. As the manufacturer continues product development, it reserves the right to change design and specifications without notice. 1.3 QUALITY ASSURANCE A. TANK Fire Suppression System shall be UL & ULC listed in accordance with UL300, UL1254, ULCORD-C1254.6. B. Microprocessor-based control board shall be ETL Listed to UL Standard 864 and CAN/ ULC-S527-11. C. TANK Fire Suppression System intended for installation and for use in accordance with the National Fire Protection Association Standards: 1. Wet Chemical Extinguishing Systems, NFPA 17A 2. National Electrical Code, NFPA 70 3. National Fire Alarm & Signaling Code, NFPA 72 D. New York City and FDNY approved under COA# 5870. E. California State Fire Marshal (CFSM), Listing No. 7085-2199:0502. 1.4 WARRANTY A. All units shall be provided with the following standard warranties: 1. TANK Fire Suppression System is warranted to be free from defects in materials and workmanship, under normal use and service, for a period of 60-months from date of shipment. B. Warranty does not cover consumable products such as batteries and nitrogen. C. The manufacturer shall not be liable for incidental and consequential losses and damages potentially attributable to malfunctioning equipment. Should any part of the equipment prove to be defective in material or workmanship within the 60-month warranty period, upon examination by the manufacturer, such part will be repaired or replaced by manufacturer at no charge. The buyer shall pay all labor costs incurred in connection with such repair or replacement. Equipment shall not be returned without manufacturer’s prior authorization, and all returned equipment shall be shipped by the buyer, freight prepaid to a destination determined by the manufacturer. D. Refer to Manufacturer’s Operation, Installation, and Maintenance (OIM) Manual for detailed descriptions of what is/is not covered and contact information for warranty claims. PART 2 - PRODUCTS 2.1 GENERAL A. A pre-engineered, fixed pipe, automatic wet chemical agent fire suppression system for protection of all hazard areas associated with cooking operations, including exhaust hoods, plenums, ductwork, and cooking appliances. 2.2 COMPONENTS A. Exhaust hood fire system components to be factory installed. B. Cylinder and Valve Assembly 1. The cylinders shall have a tin-nickel alloy plated brass valve with pressure gauge. 2. Wet chemical agent shall be contained in one or more stored pressure DOT/TC rated steel cylinder and valve assemblies. 3. Each cylinder is factory-filled with liquid fire suppressant and pressurized to 200 PSIG at 70°F. C. Distribution Nozzles 1. Nozzles shall be located to protect the exhaust ducts, plenums, and all cooking appliances requiring protection. 2. All nozzles shall be equipped with a metal blow off cap. The cap prevents contamination from entering the pipe network and is designed to pop-off upon system discharge, allowing agent to flow to the protected hazard area. 3. All nozzles shall incorporate a stamped part number to easily identify nozzle type. D. Distribution System 1. The distribution system shall consist of Copper, Schedule 40 black iron, chrome-plated or stainless-steel pipe and fittings. All exposed piping and fittings must be chrome-plated or stainless steel. 2. Fittings shall be minimum class 150. Galvanized fittings shall not be used. E. Suppression System 1. The system control equipment shall be capable of all functions associated with automatically and manually discharging the wet chemical agent from all cylinder and valve assemblies, including automatic shutdown of the heat source or fuel and electrical power to all protected areas upon system discharge. 2. Liquid Fire Suppressant shall be Aqueous Potassium Carbonate (APC). 3. All mechanical components of the actuator kit shall be enclosed. 4. The actuator kit shall be capable of automatic or manual activation means. 5. Supervisory Pressure Switch added to monitor operating system pressure. 6. For manual activation, an electrically operated manual release shall be used to actuate the system manually. 7. For automatic activation, the system will be activated by a Firestat (heat) detector. F. Electrical 1. Electrical Division to provide shunt trip breakers at main power panel, or disconnects, as designated by the Electrical Engineer; interconnection provided at hood control panel for the signal to shut down all electricity in and under the exhaust hood. Shunt trips/disconnects to accomplish shut off of electricity in the event of fire system activation by others. 2. Printed circuit board with microprocessor-based controller that provides all the necessary monitoring, timing, and supervision functions required for the reliable operation of the fire system. 3. Independent supervised loops incorporate redundancy and fault detection. 4. Real-time cloud-based monitoring connection provided with system by ownership. 5. Primary power supply, with battery backup for power loss. 6. All wiring must be in accordance to NFPA 70 and the Authority Having Jurisdiction (AHJ). 7. Electric gas valve provided for equipment below exhaust hood. Coordinate size and installation with Plumbing Division. 8. All wiring is to be in accordance with the applicable manufacturer’s instructions for the fire alarm control panel, gas shut-off valve, manual reset relay, and contractor supplied shut-off devices. PART 3 - EXECUTION 3.1 EXAMINATION A. Examine areas and conditions under which the system is installed. Do not proceed with work until unsatisfactory conditions have been corrected in manner acceptable to Installer. 3.2 APPLICATION A. Wet chemical-based fire suppression system for use in commercial kitchens. It can be mounted in the integral cabinet located at the end of the hood or offered as a wall mount package. 3.3 INSTALLATION A. As part of this item, provide wall mounted type K handheld portable fire extinguisher, placard, and mounting bracket as required in the immediate vicinity of each cooking area, per NFPA-96 and NFPA-10. Additional fire extinguishers as required in the kitchen area are to be specified by the Architect and provided by the General Contractor. B. Install in accordance with manufacturer's instructions, drawings, written specifications, manufacturer’s installation manual, and all applicable building codes. C. Six-month and twelve-month inspections, servicing, and replacement of components as per NFPA 96 to be provided by the General Contractor or Owner. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-8 1 1 DU180HFA CAPTIVEAIRE 3035 1.500 1310 ODP,PREMIUM 2.000 1.6130 3 230 7.5 701 FPM 187 19.5960561273157 FAN UNIT NO TAG QTY FAN UNIT MODEL #MANUFACTURER CFM ESP RPM MOTOR ENCL HP BHP PHASE VOLT FLA DISCHARGE VELOCITY WEIGHT (LBS)SONES 2 A2-20D-MPU 1 5 208-230 3 PHASE 60 HZ 21.5 AMPS 15.96 AMPS 30 AMPS 10 AWG 14 FAN UNIT NO TAG FAN UNIT MODEL #CONDENSER NO TONNAGE VOLTAGE PHASE FREQUENCY MCA RLA MAX FUSE SIZE MIN WIRE SIZE SEER 2 1 A2-20D-MPU 20MF-2-MOD A2 2000 2428 0.500 1026 ODP,PREMIUM 1.000 0.5950 3 230 3.4 4.3A 15A 1190 9.52611154762678 FAN UNIT NO TAG QTY FAN UNIT MODEL #BLOWER HOUSING MIN CFM DESIGN CFM ESP RPM MOTOR ENCL HP BHP PHASE VOLT FLA MCA MOCP WEIGHT (LBS)SONES 2 DX 2428 91.0°F 77.0°F 78.2°F 70.8°F ------------58.5 MBH 32.8 MBH 25.7 MBH --------------------------- FAN UNIT NO TAG COIL TYPE DESIGN CFM COOLING ENTERING DB TEMP ENTERING WB TEMP LEAVING DB TEMP LEAVING WB TEMP ENTERING FLUID TEMP LEAVING FLUID TEMP FLUID FLOW RATE PERCENT GLYCOL TOTAL CAPACITY SENSIBLE CAPACITY LATENT CAPACITY HEATING ENTERING DB TEMP LEAVING DB TEMP ENTERING FLUID TEMP LEAVING FLUID TEMP FLUID FLOW RATE PERCENT GLYCOL STEAM PRESSURE TOTAL CAPACITY SENSIBLE CAPACITY 2 A2-20D-MPU 35.0°F 12.0°F 47.0°F FAN UNIT NO TAG FAN UNIT MODEL # HEATING MODE ENTERING DB TEMP HEATING MODE TEMP RISE HEATING MODE DISCHARGE DB TEMP 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 GREASE BOX FAN BASE CERAMIC SEAL - SHIP LOOSE - FOR GREASE DUCTS MIAMI DADE CERTIFICATION - NOA-1 ALUMINUM UPBLAST 2 YEAR PARTS WARRANTY SIZE 2 UNTEMPERED COMMERCIAL DOWN DISCHARGE FOR DIRECT DRIVE AHUS MIAMI DADE CERTIFICATION - NOA-2 SUPPLY 5 TON SINGLE CIRCUIT MODULAR PACKAGED COOLING OPTION WITH HEAT PUMP FOR SIZE 2 MUA (2,000 TO 3,000 CFM), 208V/230V, 3 PHASE INSULATED BLOWER SECTION SIZE 1-2 COMMERCIAL MOD PACKAGE UNIT HEAT PUMP CONTROLS FOR UNTEMPERED FANS MIXING BOX SHELL FOR SIZE 2 MOD PACKAGE UNIT CONDENSER SUPPORT SEPARATE 120V WIRING PACKAGE (REQUIRED AND USED ONLY FOR DCV OR PREWIRE WITH VFD) - THREE PHASE ONLY SIZE 2 COOLING COIL ECOATING OPTION FOR STANDARD MPU, DX AND CHILLED WATER COILS CONDENSING UNIT LOCKING CAPS FOR SINGLE HEAT PUMP CONDENSER UNITS 2 YEAR PARTS WARRANTY FAN UNIT NO TAG QTY DESCRIPTION 1 YES FAN UNIT NO TAG EXHAUST GREASE CUP GRAVITY DAMPER WALL MOUNT SUPPLY SIDE DISCHARGE GRAVITY DAMPER MOTORIZED DAMPER WALL MOUNT 1 2 # 1 # 2 34 LBS 83 LBS CURB CURB 26.500"W X 26.500"L X 26.000"H 0.250:12.000 PITCH ALONG LENGTH, RIGHT VENTED HINGED. 31.000"W X 121.000"L X 20.000"H 0.250:12.000 PITCH ALONG WIDTH, RIGHT INSULATED MPU CURB CLIPS. NO ON FAN WEIGHT ITEM SIZE - VARIABLE SPEED CONTROL. - THERMAL OVERLOAD PROTECTION (SINGLE PHASE). - HIGH HEAT OPERATION 300°F (149°C). EXHAUST FAN MUST OPERATE CONTINUOUSLY WHILE EXHAUSTING AIR AT 300°F (149°C) UNTIL ALL FAN PARTS HAVE REACHED THERMAL EQUILIBRIUM, AND WITHOUT ANY DETERIORATING EFFECTS TO THE FAN WHICH WOULD CAUSE UNSAFE OPERATION. NORMAL TEMPERATURE TEST 26" 28" 37 3/8" 16 1/2" 2" 22 5/8" - INTERNAL WIRING. - ROOF MOUNTED FANS. - RESTAURANT MODEL. FEATURES: - DIRECT DRIVE CONSTRUCTION (NO BELTS/PULLEYS). - NEMA 3R SAFETY DISCONNECT SWITCH. 33 3/4" GREASE DRAIN. - GREASE CLASSIFICATION TESTING. - UL705 AND UL762 AND ULC-S645 ABNORMAL FLARE-UP TEST EXHAUST FAN MUST OPERATE CONTINUOUSLY WHILE EXHAUSTING BURNING GREASE VAPORS AT 600°F (316°C) FOR A PERIOD OF 15 MINUTES WITHOUT THE FAN BECOMING DAMAGED TO ANY EXTENT THAT COULD CAUSE AN UNSAFE CONDITION. 3" FLANGE. 26" 26" ROOF OPENING DIMENSIONS. 20 GAUGE CONSTRUCTION. STEEL 26" 26 1/2" 26 1/2" VENTED CURB. EXAMPLE: 7/12 PITCH = 30° SLOPE. PITCHED CURBS ARE AVAILABLE FOR PITCHED ROOFS. SPECIFY PITCH: 1/4" 1° 12" FAN #1 DU180HFA - EXHAUST FAN OPTIONS GREASE BOX. FAN BASE CERAMIC SEAL - SHIP LOOSE - FOR GREASE DUCTS. MIAMI DADE CERTIFICATION - NOA-1 ALUMINUM UPBLAST. 2 YEAR PARTS WARRANTY. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233INSTALLATION FASTENER TYPES FAN TO CURB WOOD (SG = 0.42 MIN.)STEEL (12 GAUGE MIN.) CONCRETE (2500 PSI MIN. CRACKED CONCRETE) FASTENER 5/16"-18 X 2" SELF DRILLING SCREW (ELCO DRIL-FLEX OR BETTER) 3/8" DIA. ZINC PLATED LAG BOLT 1/4"-14 DRIL-FLEX SELF DRILLING SCREW 3/8" DIA. SS HILTI KWIK BOLT TZ EXPANSION ANCHOR MINIMUM THREAD PENETRATION N/A 2-1/2"12 GAUGE 2" MINIMUM EDGE DISTANCE N/A 1-1/2"3/8"3" MINIMUM END DISTANCE N/A 2-5/8"3/8"3" MINIMUM SPACING N/A 1-1/2"3/4"5-1/2" INSTALLATION FASTENER QTY CURB TO FAN (ROOF) CURB TO FAN (WALL)WOOD (ROOF)WOOD (WALL)STEEL (ROOF)STEEL (WALL)CONCRETE (ROOF) CONCRETE (WALL) FAN MODEL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL PER SIDE TOTAL DU180 3 12 3 12 5 20 5 20 6 24 6 24 5 20 5 20 LISTED GREASE DUCT. EXHAUST FAN. § HIGH TEMP GASKET IS USED TO SEAL THE FAN TO THE TRANSITION PLATE. VENTED CURB ROOF TERMINATION. THE INNER DUCT IS FULLY WELDED TO THE TRANSITION PLATE, ALL WELDS ARE DYE TESTED. SECURED TO THE CURB BY OTHER. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-9 121" FLEX CONDUIT FOR FIELD WIRING. BLOWER DISCHARGE. 16" 10" 18 3/4" 8 5/8" LIFTING LUG. AIRFLOW. BLOWER/MOTOR ACCESS DOOR 24" SERVICE CLEARANCE REQ. SERVICE DISCONNECT SWITCH. AIRFLOW. COOLING COIL MODULE. 1" MPT CONNECTION FOR SS PITCHED DRAIN PAN. COIL ACCESS DOOR.AIRFLOW. DISCONNECT. CONDENSER 33 1/16"HEAT PUMP 1 AIRFLOW. 49 3/8" 16 1/4" 31" 20" EQUIPMENT CURB. 40 1/8" 36 3/4" 42 1/8" 47 3/4" 49 3/8" 82 1/4" 42 1/8" 178" MIN. 20" MINIMUM STRAIGHT DUCT PER AMCA* FAN #2 A2-20D-MPU - SUPPLY FAN 1. SUPPLY UNIT WITH 20" MIXED FLOW DIRECT DRIVE FAN IN SIZE #2 HOUSING. 2. INTAKE HOOD WITH EZ FILTERS. 3. DOWN DISCHARGE - AIR FLOW RIGHT -> LEFT. 4. DOWN DISCHARGE CONSTRUCTION FOR SIZE 2 UNTEMPERED DIRECT DRIVE AHUS. 5. MIAMI DADE IMPACT AND WIND LOAD CERTIFICATION +30 / -130 PSF - MIAMI DADE COUNTY PRODUCT CONTROL APPROVED. FLORIDA BUILDING CODE APPROVAL. ROOF MOUNT EXHAUST CURBS UP TO 20" HIGH MUST BE 18 GAUGE ALUMINIZED. 6. 5 TON, SINGLE CIRCUIT MODULAR PACKAGED COOLING OPTION WITH HEAT PUMP FOR SIZE 2 MODULAR PACKAGED UNIT. INCLUDES HEAT PUMP, DX COIL, FILTER/DRYER KIT, THERMAL EXPANSION VALVE, R410A REFRIGERANT, AND REFRIGERANT PIPING. (2,000 TO 3,000 CFM) WHEN ORDERED WITH OPPOSITE AIRFLOW CONDENSERS ACCESS AND COIL PIPING WILL REMAIN IN STANDARD POSITION. DRAIN AND SLEDS WILL MOVE TO THE OPPOSITE SIDE. ANY OTHER CHANGE WILL REQUIRE CLI. CONDENSERS REQUIRE SEPARATE 208V, 3 PHASE POWER SUPPLY UNLESS ORDERED WITH SINGLE POINT CONNECTION. COIL = 3EZ1001R. 7. INSULATED BLOWER HOUSING SIZES 1-2 COMMERCIAL MODULAR. 8. CONTROL PACKAGE FOR MOD PACKAGE UNIT HEAT PUMP UNIT. INCLUDES AIRFLOW PROVING SWITCH, RTULINK-ACHP BOARD AND TERMINAL BLOCKS. 9. SUPPORT SHELL FOR SIZE 2 MODULAR PACKAGE UNIT. INCLUDES CONTROL VESTIBULE. INCLUDES CONDENSER SUPPORTS. DOES NOT INCLUDE RETURN AIR OR INLET AIR DAMPER. 10. SEPARATE 120VAC WIRING PACKAGE FOR MAKE-UP AIR UNITS. OPTION MUST BE SELECTED WHEN MOUNTING VFD IN PREWIRE PANEL OR WITH DCV PACKAGE. PROVIDES SEPARATE 120VAC INPUT TO SUPPLY FAN. THIS 120V SIGNAL MUST BE RUN BY ELECTRICIAN FROM DCV TO MUA SWITCH. 11. SIZE 2 COOLING COIL ECOATING OPTION FOR STANDARD MPU, DX AND CHILLED WATER COILS. ADDS 5-6 WEEK LEAD TIME. 12. LOCKING CAPS FOR SINGLE HEAT PUMP CONDENSER UNITS. CONSISTS OF 3 LOCKING CAPS, PART# NCP-4, AND 1 KEY, PART# NC-KEY. 13. HINGED DOUBLE WALL INSULATED DOOR ASSEMBLY (BURNER/BLOWER/MPU SECTION). 14. 2 YEAR PARTS WARRANTY *NOTE: SUPPLY DUCT MUST BE INSTALLED TO MEET SMACNA STANDARDS. A MINIMUM STRAIGHT DUCT LENGTH MUST BE MAINTAINED DOWNSTREAM OF UNIT DISCHARGE AS OUTLINED IN AMCA PUBLICATION 201. WHEN USING RECTANGULAR DUCTWORK, ELBOWS MUST BE RADIUS THROAT, RADIUS BACK WITH TURNING VANES. FLEXIBLE DUCTWORK AND SQUARE THROAT/SQUARE BACK ELBOWS SHOULD NOT BE USED. ANY TRANSITION AND/OR TURNS IN THE DUCTWORK WILL CAUSE SYSTEM EFFECT. SYSTEM EFFECT WILL DRASTICALLY INCREASE STATIC PRESSURE AND REDUCE AIRFLOW. DO NOT RELY ON UNIT TO SUPPORT DUCT IN ANY WAY. FAILURE TO PROPERLY SIZE DUCTWORK MAY CAUSE SYSTEM EFFECTS AND REDUCE PERFORMANCE OF THE EQUIPMENT. SUGGESTED STRAIGHT DUCT SIZE IS 20" x 20". L ETS DI R ROOF OPENING 2" SMALLER THAN CURB DIMENSION. EXAMPLE: 7/12 PITCH = 30° SLOPE. PITCHED CURBS ARE AVAILABLE FOR PITCHED ROOFS. SPECIFY PITCH: 1/4" 1° 12" 12" MIN. 7" CLEAN OUT. TYPICAL DRAIN TRAP INSTALL NO UNIONS. RECOMMENDED COOLING COIL DRAIN TRAP CONFIGURATION. NOTES: 1) 1" DIAMETER PVC PIPE ONLY. 2) USE ONLY LOW PROFILE COUPLINGS. 3) ADD CLEAN OUT AS SHOWN. 6" 6" SW-01 BK MT-01 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 GR GR Label Description Location MT-01 Supply motor [2] SW-01 Main disconnect switch [2] Component Identification 23 BK BK BK BK BK Installed Options RD - RED BL - BLUE WH - WHITE OR - ORANGE BR - BROWN BK - BLACK PK - PINK PR - PURPLE GY - GRAY GR - GREEN YW - YELLOW WIRE COLOR DENOTES INTERNAL WIRING DENOTES FIELD WIRING NOTES 7 8RD(DCV SF1)WH (DCV N1) DCV/VFD Wiring (MAY NOT BE NEEDED DEPENDING ON OPTIONS) IF DCV IS NOT PRESENT, RD AND WH WIRES FROM SEPARATE 120VAC SOURCE Cooling Transformer(40va)TR-05 [4] BK WH 1 TR-05115 BL 24 YW N RCR1 BK RD WH WH MOCP = 10 AMPS FOR CONTROL WIRING DROP FOR DISCONNECT CONNECTION !ATTENTION ELECTRICIAN! CONNECT POWER TO THE DROP RC PS-01 R1 BK NOCNC C BL R TS-06 TS-06 RTUlink-ACHP [16] [20]Outside Air SensorSN-01 PS-01 DDP-106-313 AFS [17] 1 2 5 6 3 4 6 10 SW-02 2 208/230 3 PHASE GR BL BL BL 9 5 1 HEAT PUMP 1 R1BK BL BL BL C RC R 13 11 RD SW-02 40 Amp Rotary Disconnect [18][15] SW-06 [16-17]Overflow Switch SW-06 FL R1 Alarm 1 Airflow SN-01 BK OB GY OR W1RD SN-02 BK [20]Discharge Air SensorSN-02 O Y OB Y1 BL GY W2 W1RD Y1 W1 +C +C OutsideTemp DischargeTemp O/B BL BL YW RDRD RD BK COOL STAGE ON TIMER = 2 MIN. COOL STAGE OFF TIMER = 2 MIN. COOL HYSTERESIS = 1 MIN. STANDARD PARAMETERS CONTROL MODE = AUTOSTAGE BASED ON = OUTSIDEACTIVATE BASED ON = OUTSIDE MODE CHANGE TIME = 5 MIN. ONE HEAT PUMP STAGE 1 COOLING SETPOINT = 85°F TWO HEAT PUMPS STAGE 1 COOLING SETPOINT = 85°F STAGE 2 COOLING SETPOINT = 95°F THREE HEAT PUMPSSTAGE 1 COOLING SETPOINT = 85°FSTAGE 2 COOLING SETPOINT = 90°FSTAGE 3 COOLING SETPOINT = 95°F HEAT HYSTERESIS = 1 MIN. HEAT STAGE ON TIMER = 2 MIN. HEAT STAGE OFF TIMER = 2 MIN. O/B MODE = ENERGIZE WITH COOL STAGE 1 HEATING SETPOINT = 55°F STAGE 1 HEATING SETPOINT = 55°FSTAGE 2 HEATING SETPOINT = 45°F STAGE 1 HEATING SETPOINT = 55°FSTAGE 2 HEATING SETPOINT = 50°F STAGE 3 HEATING SETPOINT = 45°F IS FACTORY SUPPLIED Y1 SUPPLY 1HP-230V-3P-3.4FLA MOTOR INFO ELECTRICAL INFORMATIONMOTOR CIRCUIT MCA: 4.3ACONTROL CIRCUIT MCA: 1.0A MOTOR CIRCUIT MOP: 15ACONTROL CIRCUIT MOP: 15A DRAWING NUMBER JOB MODELSHIP DATEA5599506-2 5599506 - Island Donuts (CAS tempered) 8/15/2022 SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-10 1 DCV-1111 UTILITY CABINET LEFT 03 - UTILITY CABINET LEFT HOOD # 1 1 LIGHT 1 FAN SMART CONTROLS DCV EXHAUST SUPPLY 3 3 2.000 1.000 230 230 7.5 3.4 NO TAG PACKAGE #LOCATION SWITCHES LOCATION QUANTITY OPTION FANS CONTROLLED TYPE ɸ HP VOLT FLA DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-1 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. BREAKER PANEL TO PRIMARY CONTROL PANEL Responsibility: Electrician BREAKER PANEL PRIMARY CONTROL PANEL BREAKER SIZE SHOWN IS THE MAXIMUM ALLOWED BREAKER 1PH CONTROL POWER. DO NOT WIRE TO GFCI OR SHUNT TRIP BREAKER. Hot Neutral H1 N1120 V 15 A Ground GND 1ST HOOD LIGHT BREAKER SHARED W/ CONTROL POWER. SWITCH #1 WIRE TO VFD QUICK CONNECTOR BREAKER 3PH MCA: MOCP: LINE LINE Ground EXH-1 SM-1 GND L1 L2 LINE L3230 V 9.4 A 20 A BREAKER 3PH WIRE TO VFD QUICK CONNECTOR MCA: MOCP: LINE LINE 230 V Ground SUP-2 SM-2 GND L4 L5LINEL64.2 A 15 A BREAKER PANEL TO FANS Responsibility: Electrician BREAKER PANEL FANS POWER TO CONDENSER LINE LINE208-230 30 Amps SUP-2 LINE COND 1 3 PHASE CONTROL PANEL TO FANS Responsibility: Electrician PRIMARY PANEL FANS Load Wiring WIRE TO VFD QUICK WIRE TO DISCONNECT CONNECTOR MUST HAVE ITS OWN CONDUIT DO NOT SHARE CONDUIT! FLA: HP: VOLT: EXH-101LOAD LEG 1 LOAD LEG 2 GND GROUND FAN: SM-1 LOAD LEG 3 U1 V1 W1 7.5 2.000 230 V Load Wiring BLACK BLACK BLACK GREEN WIRE TO VFD QUICK CONNECTOR WHITE RED FLA: HP: VOLT: MUST HAVE ITS OWN CONDUIT DO NOT SHARE CONDUIT! IF VFD MOUNTED IN 2ND PANEL, WIRE SF SIGNAL FROM PANEL WITH ECPM03. U2 V2 W2 LOAD LEG 1 LOAD LEG 2 LOAD LEG 3 GND GROUND SUP-202FAN: SM-2 N1 120V NEUTRAL 120V HOT N1 3.4 1.000 230 V H1 CONTROL PANEL TO ACCESSORY ITEMS Responsibility: Electrician CONTROL PANEL COMPONENT ALL SWITCHES FACTORY WIRED CAT-5 CONNECTION CONTROL PANEL SWITCHES TO J4 CONTROL PANEL HOOD LIGHTS TO 1400 W MAX WIRE TO J-BOX ON TOP OF HOOD B1 W1 GND BLACK WHITE GREEN HOOD LIGHTS 1 WIRE TO CONTROL BOARD. INSTALL SENSOR IN ROOM AWAY FROM HEAT SOURCES. DO NOT INSTALL SENSOR CONTROL PANEL KITCHEN TEMP TO SENSOR ON THE CEILING GRID, SEE MANUAL. T1A T1B ROOM TEMP FACTORY WIRED TEMPERATURE SENSOR. MOUNTED IN EXHAUST DUCT CONTROL PANEL DUCT SENSOR TO T2A T2B HOOD 1 RISER 1 CONTROL PANEL GAS VALVE TO 120V ONLY ONLY ENERGIZED THROUGH LCD HMI WHEN FIRE SYSTEM ARMED. GAS N1 HOT TO GAS VALVE NEUTRAL GAS SOLENOID THE FOLLOWING CONNECTIONS MAY OR MAY NOT BE REQUIRED BASED ON JOBSITE SPECIFICATIONS CONTROL PANEL EXTERNAL SIGNAL FOR SHUNT TRIP ST TERMINAL IS ENERGIZED IN FIRE CONDITION. CONTROL PANEL EXTERNAL SIGNAL FOR CONTACTOR COIL KS TERMINAL IS DE-ENERGIZED IN FIRE CONDITION. ST N1 NEUTRAL FROM SHUNT COIL HOT TO SHUNT COIL SHUNT COIL KS N1 NEUTRAL_TO_CONTACTOR_COIL HOT_TO_CONTACTOR_COIL CONTACTOR_COIL SPARE CONTACTS WILL MAKE CONTROL PANEL ON/OFF WITH DRY CONTACT SUPPLY FAN COMMON TO NORMALLY OPENWHEN SUPPLY FAN IS ON. GROUP 1 SFC1 SFO1 COMMON NORMALLY OPEN SFC2 SFO2 COMMON NORMALLY OPEN WIRE TO ECPM03 TERMINALS. CONFIGURABLE OUTPUT. DCV SPEED (TOTAL) 0-10V OUTPUT ON PCB SEE ECPM03 OWNERS MANUAL. TO BMS + -VO+ VO- WIRE TO VFD TERMINAL STRIP.PROPORTIONAL TO FREQUENCY. VFD ANALOG (EACH VFD) 0-10V OUTPUT IN VFD SEE VFD OWNERS MANUAL. TO BMS + -30 2 CONTROL PANEL EXTERNAL TO SWITCH SIGNAL SWITCH THROUGH BMS WILL ACTIVATE ZONE1 FANS AND LIGHTS H1 IO1 BMS SWITCH C NO CONTROL PANEL GAS VALVE TO 24V DC ONLY ONLY ENERGIZED THROUGH LCD HMI WHEN FIRE SYSTEM ARMED. (NOT NEEDED IF USING 120V GAS VALVE). LGV N1D POSITIVE TO GAS VALVE NEGATIVE GAS SOLENOID SYSTEM DRY SPARE FIRE CONTACT CONTROL PANEL SPARE CONTACTS WILL MAKE C2 TO AR2 WHEN SYSTEM IS ARMED. THEY ARE USED TO DISABLE EQUIPMENTOR PROVIDE SIGNALS. (NOT FOR BUILDING FIRE ALARM WHICH MUST BE WIRED DIRECTLY TO THE ANSUL ALARM INITIATING SWITCH LOCATED IN ANSUL AUTOMAN) C2 AR2 COMMON NORMALLY OPEN CONTROL PANEL TO FIRE SYSTEM Responsibility: ALARM CONTRACTOR CONTROL PANEL COMPONENT CONTROL PANEL BUILDING SIGNAL FOR FIRE ALARM PANEL AL1 AL2 J9 BUILDING ALARM PANEL FIRE INPUT WIRE DIRECTLY TO CORE CIRCUIT BOARD. AL1 WILL MAKE AL2 IN FIRE CONDITION. CONTROL PANEL BUILDING SIGNAL FOR TROUBLE TROUBLE RELAY CONTACTS WILL MAKE TBC TO TBL IN TROUBLE CONDITION. BUILDING ALARM PANEL ALARM TBC TBL COMMON NORMALLY CLOSED DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-2 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. CONTROL PANEL TO FIRE SYSTEM Responsibility: CERTIFIED INSTALLER CONTROL PANEL COMPONENT FIRE STAT SUPERVISED LOOP May be mixed factory and field wiring. See Installation Schematic. Multiple fire sensors possible. HIGH TEMP WIRE (842 F), PN: SLPCON-xFT required for all Supervised Loop wiring in contact with a hood. All other wiring shall be PN: 6320UL, Belden or similar. 21 22 23 24 FS-01 BK WH Fire Stat FS-02 BK WH Fire Stat CONTROL PANEL MOUNTED FIRE TO DUCT DETECTION STAT(S) FIRE STATS CONTROL PANEL SYSTEM PULL TO FIRE STATION MANUAL ACTUATION LOOP / REMOTE FIRE SYSTEM LOOP. Multiple manual actuation possible. Multiple manual actuation possible. A Plug jumper with wires from pin1 to pin4 and from pin2 to pin3 is mounted on J10, remove the jumpers and wire in the supervised actuation loop. Microswitch MS-01 is optional for fire system interlock. Auxiliary Interlock (AUX-01): Wire AU1 / AU2 of adjacent Master FS panel(s) in each manual activation loop for simultaneous activation. See Fire system drawings for more information. 101 102 103 104 AUX-01 AU1 AU2 PULL STATION MS-01 C NO Micro SW MAD-01CNO Manual ActuationDevice Adjacent FS Panel CAT-5 CONNECTIONCONTROL PANEL MASTER FS TO BOARD. PLACE END OF LINE PLUG EOL120AIN EMPTY JACK. PN: EOL120A CORE PCB ADDITIONAL DEVICES MAY BE INLINE. ECPM03 UNLESS VFD, PCU, OR OTHER COMPONENT IN SERIES. J3 J5 J6 CONTROL PANEL MASTER FS TO PANEL WIRE TO LIKE TERMINALS IN ALL CORE PANELS THAT MUST ACTIVATE TOGETHER. SET MASTER & SLAVE DIP SWITCHES PER FIRE SYSTEM SHIELDED TWISTED PAIRINTERLOCK NETWORK MASTER CORE MANUAL. CA CB CC BLACK RED SHIELD CA CB CC SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-11 DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-3 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-4 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-12 DESCRIPTION OF OPERATION: 5599506 Island Donuts (CAS tempered) DCV-1111 8/15/2022 INSTALL ECP #1-5 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER WH BK A B C D E F G H I 1 2 3 4 5 6 7 8 9 10 MOTOR POWER CIRCUIT PANEL LID COMPONENT LIST LABEL DESCRIPTION ST-X varies Starter OL-X varies Overload C-X varies Contactor TS-x A/CP-PO-T4"-EXPL Duct Thermostat 120 VAC RELAY RA-x 24 VDC RELAY RD-x PS-1 MDP18-24A-1C Power Sup. 24VDC BK RA-x 34.110.0184.0 120V Relay DPDT WH RA-x 34.110.0184.0 120V Relay DPDT GR UNLESS SPECIFIED OTHERWISE, ALL FACTORY AC WIRING 16 AWG. ALL FACTORY DC WIRING 18 AWG. N1 H1 DC-GNDDC+8H1 7PCU 6ST 5KS 4KTS 3GAS 2AR1 1N1 120VJ9 5OV1 4SF1 3EF1 2B1 1IO1 120VJ7 AR1 H12x N12x B1 EF1 SF1 BK IO1 BK BK BK JUMPERW1 BK 14AWG BK 64 RD-1 BL PRDC+RO1 RD-x 34.110.0188.0 24VDC Light Relay BK WHSF1RA-2 RD-1 24V 1 2 3 4 5 6 7 8 9 10 11 1213 14 J6 N1N1RO1 FAN PANEL COOLING DRY CONTACTS (SHOWN DE-ENERGIZED) HOOD LIGHTS J3 ECPM03/DAISY CHAIN AR1 H1JUMPER FIRE SYSTEM BK BK BK GAS KS ST NOTE: Configure ECPM03 for CORE SM-1 SM-2 ECPM03 J10 IL1AIL1BJUMPER MAKE UP AIR INTERLOCK. 1 2 11 1 JUMPER 1 2 11 1 JUMPER NOTE: All items on ECPM03 J3 line to be daisy chained from one component to the next, with EOL120A at end of line. Place PN: EOL120A in empty RJ45 port. J3 ECPM03 or Previous EOL J5 MASTER CORE RA-2-1 SFC1 SFO1 14 AWG YW RA-2-2 SFC2 SFO2 14 AWG YW FACTORY WIRING SCHEMATIC CIRCUIT BOARDS ECPM03 DCV Rev. 2.14.00 HMI Rev. 2.14.00 SC-24 X 18 X 8.62 BOX CONTROL INPUT 120V H1=LINE, N1=NEUTRAL, 15A BREAKER. DO NOT CONNECT TO SHUNT TRIP BREAKER. SEE INSTALLATION SCHEMATIC FOR ADDITIONAL REQ. NOTE: IF VFD HAS 1PH 240V INPUT, USE L1 & L2 ONLY. IF VFD HAS 1PH 120V INPUT, USE L1 & N ONLY. LEGEND FIELD WIRING FACTORY WIRING BK- BLACK BL- BLUE BR- BROWN OR- ORANGE WH- WHITE OR/BL- OR/BL STRIPE BL/RD- BL/RD STRIPE RD/GN- RD/GN STRIPE WH/BL- WH/BL STRIPE YW- YELLOW GY- GREY PR- PURPLE RD- RED GR- GREENWH/BLBLH1N1DC-DC+LN -+ PS-01 AC 24V GNDDCKSKSBKKS BK BK GAS ST BKEF1 PRWH GR/YWWH/BLBLJ4 J5 FAN SECONDARY PANEL COOLING IF NECESSARY EF1 WHBK JUMPER ECPM03 J10 IL2AIL2BTERMINAL GAS USED FOR 120V POWERED GAS VALVES ONLY 5599506 Island Donuts (C... FACTORY DCV-1111 8/15/2022 ECP #1-6 Demand Control Ventilation, w/ control for 1 Exhaust Fan, 1 Supply Fan, Exhaust on in Fire, Lights out in Fire, Fans modulate based on duct temperature. INVERTER DUTY 3 PHASE MOTOR REQUIRED FOR USE WITH VFD. Room temperature sensor shipped loose for field installation.Verify distance between VFD and Motor; additional cost could apply if distance exceeds 50 feet. BK BK BK BK BK BK BK BK BK BK BK BK U/T1 V/T2 W/T3 L1 L2 L3/N GR GR GND VFD: HP: MTR: FLA: P107: P108: P410: P150: P100: P194: P101: P131: P167: P103: P102: L1 L2 L3 14 AWG 3 PH 20 A 230 V U1 V1 W1 SM-1 ESV222N02YXB571 225 01 01 11 78 01 7.5 2.000 EXH-1 N/A N/A 73.4 73.4 0.0 GND BK BK BK BK BK BK BK BK BK BK BK BK U/T1 V/T2 W/T3 L1 L2 L3/N GR GRGND VFD: HP: MTR: FLA: P107: P108: P410: P150: P100: P194: P101: P131: P167: P103: P102: L4 L5 L6 14 AWG 3 PH 15 A 230 V U2 V2 W2 SM-2 ESV751N02YXB571 225 01 01 21 80 01 3.4 1.000 SUP-2 N/A N/A 63.6 63.7 0.0 GND SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-13 A B C D E F G H I 1 2 3 4 5 6 7 8 9 10 FACTORY WIRING SCHEMATIC CORE FIRE PROTECTION COMPONENT LIST LABEL DESCRIPTION 120 VAC RELAY RA-x 24 VDC RELAY RD-x 24 VOLT BATTERY PACK5 AMP FUSE RD SHIELDED TWISTED PAIR PCB-2 J3-2 J4-1 J3-11 J4-3 J4-2 J4-8 J4-9 J4-12 J3-14 J4-5 J3-13 J3-4 J4-6 J3-10 J2-1 J2-2 J2-3 J2-4 J7-2 J7-3 J7-1 J3-1 J3-3 RD RD BR RD ALL 18AWG RD BK ORRD PKRD BRRD RD OR/BL BK 18AWG BK BK J3-5 J1-1 J1-2 RD BK BK RD FIRE STAT SUPERVISED LOOP May be mixed factory and field wiring. See Installation Schematic. Multiple fire sensors possible. + + RD BK BK RD Shield BK RD RS-485 CORE INTERLOCK NETWORK. Connection to other CORE Panels or Communication Module. See Installation Schematic for Connection. N1D 3xH1D3x DISCONNECT J1 21 22 23 24 16AWG WHN1 H1 PN: 1606-XLP-60EQ Adjust power supply to 27.5 Volts with an accurate Digital Volt Meter or with an HMI plugged into the CORE board. NL +-PSM-2 60W GR BK GND PCB-2 PCBCORE-APP CORE PCB PSM-2 1606-XLP-50E CORE POWER SUPPLY WS-x varies Water Solenoid LT-06 PNL-1163-0UR 24V Red Ind. Light LL-01 AQ5510 Surf. Level Sensor AA-01 SCE120LA3FP1B Audible Alarm PB-01 D7-F2X11 Prime/Reset Switch SW-04 BZ-2RQ1-A2Tamper Switch SP-1 50000-805Surfactant Pump PB-01 Prime / Reset RD-20 Trouble Relay RD-17 Fire Relay DRY CONTACTS (SHOWN DE-ENGERGIZED) AA-01 Audible Alarm SW-04 Door Tamper Switch C NO FS-01 BK WH Fire Stat FS-02 BK WH Fire Stat HIGH TEMP WIRE (842 F), PN: SLPCON-xFT required for all Supervised Loop wiring in contact with a hood. All other wiring shall be PN: 6320UL, Belden or similar. Factory mounted hood sensors will be terminated at junction box on top of hood. GV-1 varies 24v DC Gas Valve INTERLOCK FOR AUTOMAN ACTIVATION. Used for activating 120V automan or adjacent Master CORE panels during active Fire Condition. RD-18-1 YW J3-16 J3-8 BR 38 LT-6 R FIRE INDICATOR DIP Switch ATTENTION: LOW-VOLTAGE DC OR SIGNALING WIRE SHOULD BE ROUTED IN SEPARATE CONDUIT FROM ALL AC SOURCES. RD/GNRDRD-19 Equipment Relay COOKING EQUIPMENT DISABLE RELAY. For UDS Kill Switch, wire EKC and EKS terminals to like terminals in UDS panel. RD-19-1 EKC EST EKS YW INTERLOCK FOR AUTOMAN ACTIVATION. Used for activating 120V automan or adjacent Master CORE panels during active Fire Condition. RD-18-1 YW RD OR/BLRD-18 Auxiliary Interlock Relay FS-XX 12-F28021-000360 Duct Fire Sensor LT-05 PNL-1163-0UY 24V YLW Ind. Light PS-01 Station STI-SS2431 Remote Puill/Push FOR SHIPMENT J10-1 J10-2 J10-3 J10-4 RD BK BK RD 101 102 103 104 MANUAL ACTUATION LOOP / REMOTE FIRE SYSTEM LOOP. Multiple manual actuation possible. A Plug jumper with wires from pin1 to pin4 and from pin2 to pin3 should be mounted on J10 if there is no manual actuation device and no microswitch. Jumper if water valve supervision switch is used MAD-01CNO Manual Actuation Device MS-01 C NO Micro SW 1 2 3 4 5 6 7 8 SW1OPEN PUT END OF LINE PLUG IN EMPTY RJ45 J3 ECPM03 UNLESS PCU AFM OR OTHER COMPONENT IN SERIES. CAT-5 WIRING (MASTER ONLY) FIELD WIRED IF REMOTE PREWIRE RD-XX PLC-RPT-24DC/21 24VDC Phoenix Relay AUX-01 AU1 AU2 Auxiliary Interlock (AUX-01): Wire AU1 / AU2 of adjacent Master CORE panel(s) in each manual activation loop for simultaneous activation. AU1/AU2 will have continuity for 10 seconds if adjacent panel goes into fire condition, activating this CORE Panel but allowing for a reset after 10 seconds. NOTE: AU1/AU2 terminals of CORE Panel should not be wired into its own manual activation loop.Adjacent CORE Panel Master CORE set DIP SW 8 to CLOSED position. Slave CORE with address 1 set DIP SW 8 to CLOSED position. All other CORES set DIP SW 8 OPEN. 18AWG LEGEND FIELD WIRING FACTORY WIRING BK- BLACK BL- BLUE BR- BROWN OR- ORANGE WH- WHITE OR/BL- OR/BL STRIPE BL/RD- BL/RD STRIPE RD/GN- RD/GN STRIPE WH/BL- WH/BL STRIPE YW- YELLOW GY- GREY PR- PURPLE RD- RED GR- GREEN FIRE INDICATOR FAULT CONDITION FLASH CODES 2 Release Solenoid 3 Pressure Switch 4 Auxiliary Fault 5 Microcontroller Fault 6 N/A 7 Supervised Loop 8 Ground Fault 9 Surfactant Low 10 Battery Voltage Low 11 AC Power Failure 12 Door Tamper Switch 13 Test Mode 14 CORE Interlock Network 15 Fault on Hood in Interlock Network 16 Fault on PCU in Interlock Network FIRE ALARM SYSTEM DRY CONTACTS. Termials AL1 & AL2 make in FIRE. To Building Fire Alarm Panel J9 AL1 AL2 J3-7 FIRE SYSTEM DRY CONTACTS. Dry contacts will make C2 to AR2 when system is armed. RD-17-1 C2 AR2 14 AWG YW TROUBLE RELAY. Contact terminals TBC & TBL make if there is trouble. Contact terminals TBC & TOK make if the system is ok. RD-20-1 TBC TBLTOK YW RD PS OR J4-9 PS EWC-PRESSUREPressure Switch PR RS SW-05-1 Test Armed 3 4 YW RS-1 RELEASE SOLENOID BLBR RD ORSW-05-2 Test Armed34 J4-13 SW-05 ZB5AD2TEST/ARM Switch RS2PRSW-05-1 Test Armed 3 4 YW PS-1 Pressure Switch WH PWS-01 24VDC 18W POWER 24VDC Power Suppl CA CB CC AU1AU1 AU2AU2 TR2 MAD-01 DEVICEMANUAL ACTIVATION GAS VALVES SHOULD BE WIRED TO MASTER CORE BOARD ONLY. RDRD GV-1 24V DC Gas ValveLGVPK TERMINAL LGV USED FOR 24VDC POWERED GAS VALVES ONLY. 5599506 Island Donuts (C... FACTORY DCV-1111 8/15/2022 ECP #1-7 Fire System #1 TANK FS - 4.0/4.0. Tank-based Fire Protection System equipped with Electronic Detection utilizing CORE board as a Listed Release Mechanism. Installed in Hood Utility Cabinet with integral hood prewire panel. FS-1: MASTER SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-14 CONTROL PANEL. LCD INTERFACE. DUCT TEMPERATURE SENSOR. ROOM TEMPERATURE SENSOR. DEMAND CONTROL VENTILATION HOOD CONTROL PANEL SPECIFICATIONS: -CONTROLS SHALL BE LISTED BY ETL (UL 508A) AND SHALL COMPLY WITH DEMAND VENTILATION SYSTEM TURNDOWN REQUIREMENTS OUTLINED IN IECC 403.2.8 (2015). -THE CONTROL ENCLOSURE SHALL BE NEMA 1 RATED AND LISTED FOR INSTALLATION INSIDE OF THE EXHAUST HOOD UTILITY CABINET. THE CONTROL ENCLOSURE MAY BE CONSTRUCTED OF STAINLESS STEEL OR PAINTED STEEL. -TEMPERATURE PROBE(S) LOCATED IN THE EXHAUST DUCT RISER(S) SHALL BE CONSTRUCTED OF STAINLESS STEEL. -A DIGITAL CONTROLLER SHALL BE PROVIDED TO ACTIVATE THE HOOD EXHAUST FANS DYNAMICALLY BASED ON A FIXED DIFFERENTIAL BETWEEN THE AMBIENT AND DUCT TEMPERATURES SENSORS. THIS FUNCTION SHALL MEET THE REQUIREMENTS OF IMC 507.1.1. -A DIGITAL CONTROLLER SHALL PROVIDE ADJUSTABLE HYSTERESIS SETTINGS TO PREVENT CYCLING OF THE FANS AFTER THE COOKING APPLIANCES HAVE BEEN TURNED OFF AND/OR THE HEAT IN THE EXHAUST SYSTEM IS REDUCED. -A DIGITAL CONTROLLER SHALL PROVIDE AN ADJUSTABLE MINIMUM FAN RUN-TIME SETTING TO PREVENT FAN CYCLING. -VARIABLE FREQUENCY DRIVES (VFDS) SHALL BE PROVIDED FOR FANS AS REQUIRED. THE DIGITAL CONTROLLER SHALL MODULATE THE VFDS BETWEEN A MINIMUM SETPOINT AND A MAXIMUM SETPOINT ON DEMAND. THE DUCT TEMPERATURE SENSOR INPUT(S) TO THE DIGITAL CONTROLLER SHALL BE USED TO CALCULATE THE SPEED REFERENCE SIGNAL. -THE VFD SPEED RANGE OF OPERATION SHALL BE FROM 0% TO 100% FOR THE SYSTEM, WITH THE ACTUAL MINIMUM SPEED SET AS REQUIRED TO MEET MINIMUM VENTILATION REQUIREMENTS. -AN INTERNAL ALGORITHM TO THE DIGITAL CONTROLLER SHALL MODULATE SUPPLY FAN VFD SPEED PROPORTIONAL TO ALL EXHAUST FANS THAT ARE LOCATED IN THE SAME FAN GROUP AS THE SUPPLY FAN. -THE SYSTEM SHALL OPERATE IN PREP MODE DURING LIGHT COOKING LOAD OR COOL DOWN MODE WHEN SUFFICIENT HEAT REMAINS UNDERNEATH THE HOOD SYSTEM AFTER COOKING OPERATIONS HAVE COMPLETED. OPERATION DURING EITHER OF THESE PERIODS WILL DISABLE THE SUPPLY FANS AND PROVIDE AN EXHAUST FAN SPEED THAT IS EQUAL TO THE MINIMUM VENTILATION REQUIREMENT. -A DIGITAL CONTROLLER SHALL DISABLE THE SUPPLY FAN(S), ACTIVATE THE EXHAUST FAN(S), ACTIVATE THE APPLIANCE SHUNT TRIP, AND DISABLE AN ELECTRIC GAS VALVE AUTOMATICALLY WHEN FIRE CONDITION IS DETECTED ON A COVERED HOOD. -A DIGITAL CONTROLLER SHALL ALLOW FOR EXTERNAL BMS FAN CONTROL VIA DRY CONTACT (EXTERNAL CONTROL SHALL NOT OVERRIDE FAN OPERATION LOGIC AS REQUIRED BY CODE). -AN LCD INTERFACE SHALL BE PROVIDED WITH THE FOLLOWING FEATURES: A. ON/OFF PUSH BUTTON FAN & LIGHT SWITCH ACTIVATION. B. INTEGRATED GAS VALVE RESET FOR ELECTRONIC GAS VALVES (NO RESET RELAY REQUIRED). C. VFD FAULT DISPLAY WITH AUDIBLE & VISUAL ALARM NOTIFICATION. D. DUCT TEMPERATURE SENSOR FAILURE DETECTION WITH AUDIBLE & VISUAL ALARM NOTIFICATION. E. MIS-WIRED DUCT TEMPERATURE SENSOR DETECTION WITH AUDIBLE & VISUAL ALARM NOTIFICATION. F. A SINGLE LOW VOLTAGE CAT-5 RJ45 WIRING CONNECTION. G. AN ENERGY SAVINGS INDICATOR THAT UTILIZES MEASURED KWH FROM THE VFDS. SEQUENCE OF OPERATIONS: THE HOOD CONTROL PANEL IS CAPABLE OF OPERATING IN ONE OR MORE OF THE FOLLOWING STATES AT ANY GIVEN TIME: -AUTOMATIC: THE SYSTEM OPERATES BASED ON THE DIFFERENTIAL BETWEEN ROOM TEMPERATURE AND THE TEMPERATURE AT THE HOOD CAVITY OR EXHAUST DUCT COLLAR. FANS ACTIVATE AT A CONFIGURABLE TEMPERATURE DIFFERENTIAL THRESHOLD. DEPENDING ON THE JOB CONFIGURATION EACH FAN ZONE CAN BE CONFIGURED AS STATIC OR DYNAMIC. THESE TERMS REFER TO WHETHER A VARIABLE MOTOR (SUCH AS EC MOTORS OR VFD DRIVEN MOTORS) MODULATE WITH TEMPERATURE. IF THE PANEL IS EQUIPPED WITH VARIABLE SPEED FANS AND THE ZONE IS DEFINED AS "DYNAMIC", THESE WILL MODULATE WITHIN A USER-DEFINED RANGE BASED ON THE TEMPERATURE DIFFERENTIAL. PANELS EQUIPPED WITH VARIABLE SPEED FANS AND A FAN ZONE DEFINED AS "STATIC", FANS WILL RUN AT A SET SPEED CALCULATED FOR THE DRIVE. DEMAND CONTROL VENTILATION SYSTEMS ARE CAPABLE OF MODULATING EXHAUST AND MAKE UP AIR FAN SPEEDS PER THE REQUIREMENTS OUTLINED IN IECC 403.2.8. -MANUAL: THE SYSTEM OPERATES BASED ON HUMAN INPUT FROM AN HMI. -SCHEDULE: A WEEKLY SCHEDULE CAN BE SET TO RUN FANS FOR A SPECIFIED PERIOD THROUGHOUT THE DAY. THERE ARE THREE OCCUPIED TIMES PER DAY TO ALLOW FOR THE USER TO SET UP A TIME THAT IS SUITABLE TO THEIR NEEDS. ANY TIME THAT IS WITHIN THE DEFINED OCCUPIED TIME, THE SYSTEM WILL RUN AT MODULATION MODE AND FOLLOW THE FAN PROCEDURE ALGORITHM BASED ON TEMPERATURE DURING THIS TIME. DURING UNOCCUPIED TIME, THE SYSTEM WILL HAVE AN EXTRA OFFSET TO PREVENT UNINTENDED ACTIVATION OF THE SYSTEM DURING A TIME WHERE THE SYSTEM IS NOT BEING OCCUPIED. -OTHER: THE SYSTEM OPERATES BASED ON THE INPUT FROM AN EXTERNAL SOURCE (DDC, BMS OR HARD-WIRED INTERLOCK). FIRE:UPON ACTIVATION OF THE HOOD FIRE SUPPRESSION SYSTEM, THE EXHAUST FAN WILL COME ON OR CONTINUE TO TO RUN, THE HOOD MAKEUP AIR WILL SHUTDOWN, AND A SIGNAL WILL BE SENT FOR ACTIVATING THE SHUNT TRIP BREAKER PROVIDED BY THE ELECTRICIAN. FUEL GAS WILL SHUT OFF VIA A MECHANICAL/ELECTRICAL GAS VALVE ACTUATED BY THE HOOD FIRE SUPPRESSION SYSTEM. - SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-15 TAG PART #CFM GPM ZON E COVEREDBY SP WEIGHT VELOCITY QTY DESCRIPTION P1 DW1817DWLT-2R-S 3035 -0.004 27.78 1717.46 1 DOUBLE WALL DUCT - 18" INNER DUCT, 17" LONG - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P2 DW1845DWASY-2R-S 3035 -0.042 26.22 1717.46 1 DOUBLE WALL DUCT - 18" INNER 45 DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P3 DW1847DWAJD-2R-S 3035 -0.008 107.98 1717.46 1 DOUBLE WALL ADJUSTABLE DUCT - 18" INNER DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. MIN LENGTH = 11" / MAX LENGTH = 48.5" / ADJUSTMENT = 30.5" / ADJUSTABLE SECTION MAY NEED TO BE CUT. INCLUDES SINGLE AND DOUBLE WALL "V" CLAMPS. P4 DW2226SADKIT 8.80 1 DUCT - HORIZONTAL SADDLE SUPPORT KIT, USED WITH 22" OD - INCLUDES UNI-STRUT CUT TO LENGTH, DW2226SAD, & HARDWARE BAG 4. P5 ASSEMBLED W/P6 DW18DWYTEASY-2R-S 3035 -0.07 65.88 1717.46 1 DOUBLE WALL DUCT - 18" INNER Y TEE DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P6 ASSEMBLED W/P5 DW18DWACCDOORCOV-2R-S 26.16 1 DOUBLE WALL DUCT - 18" INNER ACCESS DOOR & 22" ACCESS DOOR COVER WITH CLAMPS - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. P7 DW1847DWAJD-2R-S 3035 -0.009 107.98 1717.46 1 DOUBLE WALL ADJUSTABLE DUCT - 18" INNER DUCT - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL. MIN LENGTH = 11" / MAX LENGTH = 48.5" / ADJUSTMENT = 30.5" / ADJUSTABLE SECTION MAY NEED TO BE CUT. INCLUDES SINGLE AND DOUBLE WALL "V" CLAMPS. P8 ASSEMBLED W/P9 DW184550DWLTTP-2R-S 3035 -0.012 75.96 1717.46 1 DOUBLE WALL DUCT - 18" INNER DUCT, 45.5" LONG - 2 LAYERS REDUCED CLEARANCE - 22" STAINLESS STEEL OUTER SHELL - USED WITH TRANSITION PLATE. P9 ASSEMBLED W/P8 DW2618TP 3035 10.58 1717.46 1 DUCT TO CURB TRANSITION, 26-1/2" CURB TO 18" DUCT, 16 GA ALUMINIZED. USED ON BDU18 & 20. SYSTEM AT P9 -1.443 0.00 3M-2000PLUS 0.80 3 DUCT - 3M FIRE BARRIER 2000 PLUS SILICONE - USED AS SEALANT TO SEAL DUCT JOINTS. DW18DWCLASY-2R-S 8.70 1 DUCT - 18" DUCT - 22" DOUBLE "V" CLAMP - 2R INSULATION & SINGLE "V" CLAMP INCLUDED - REDUCED CLEARANCE. TOTAL WEIGHT 468.44 HORIZONTAL VERTICAL TYPE DUCT DIAMETER SUPPORT SPACING (FT) 2R (18")8"7' 10"7' 12"7' 14"7' 16"7' 18"5' 20"5' 22"5' DOUBLE WALL FACTORY BUILT DUCTWORK - ALL DUCTWORK IS REQUIRED TO BE INSTALLED WITH THE MAXIMUM SUPPORT SPACING LISTED BELOW. - FOR A COMPLETE LIST OF APPROVED SUPPORT METHODS, SEE THE ENTIRE INSTALLATION AND OPERATION MANUAL - DUCTWORK SHALL SLOPE NOT LESS THAN 1/16" PER LINEAR FOOT TOWARDS THE HOOD OR AN APPROVED GREASE COLLECTION RESERVOIR. - WHERE HORIZONTAL DUCTS EXCEED 75 FEET IN LENGTH, THE SLOPE SHALL NOT BE LESS THAN 3/16" PER LINEAR FOOT. 24"5' WALL SUPPORT (FT) CURB SUPPORT (FT) FLOOR SUPPORT (FT) 18'24'24' 3R & 3Z (5"-24")10'24'24' 3Z (26" -36")10'20'20' 26"5' 28"5' 30"5' 32"5' 34"5' 36"5' 2R & 2R HT (5"-16")20'24'24'7"7' 6"7' 5"7' DO NOT LEAK TEST USING SMOKE BOMBS CONTAINING CHLORINES/CHLORIDES. CONSULT WITH CAPTIVEAIRE FOR PROPER LEAK TESTING METHODS. SHEET NO. SCALE: DWG.#: DRAWN DATE: BY: REVISIONS www.captiveaire.com ACCORDANCENo. 96BUILTNFPAWITHINSLIDTER5599506 MASTER DRAWING reg65Island Donuts (CAS tempered)363 Atlantic Blvd,Units 6 & 7Jacksonville Office25 N. Market St., Office# 229, Jacksonville, FL, 32202 PHONE: (904) 463-6242 FAX: (919) 227-5923 EMAIL: reg65@captiveaire.comAtlantic Beach, FL, 32233P1 P2 P4 P5 P6 P7 P8 P9 25.45" 67.5"MAX 50.5" 30"MIN 110"MAX 98" 72.5"MIN 18" 22" 28.50" 48"MAX 36" 21.5"MIN DUCTWORK #1 SIDE VIEW P1 P2 P4 P5P6 P7 P8 P9 DUCTWORK #1 SE VIEW ESTIMATED DUCT RUN SHOWN. FIELD CONFIRM ALL ELEVATIONS AND OFFSETS REQUIRED. FOR REFERENCE ONLY SHEET TITLE:SHEET DATE: DRAWN BY: CHECKED BY: ABS CMD370 15th Ave S; Units A & BJacksonville Beach, FL 32250904.249.0698 pDOHERTY SOMMERSARCHITECTS ENGINEERS, INC.904.241.0691 fwww.dsae.netFlorida Certificate of Auth No: 00009393Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS. THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUT EXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.CAREN M. DOHERTY, P.E.FL P.E. #-55021NO.REVISIONDATE08-23-22ISLAND DONUTSTENANT BUILD-OUTATLANTIC BEACH, FL 32233363 ATLANTIC BLVD - UNITS 6 & 7KITCHEN HOODM-16 THE BUILDING IS CONSTRUCTED WITH LOAD-BEARING CMU EXTERIOR WALLS AND WOOD ROOF TRUSSES. OCCUPANCY CALCULATIONSPER NFPA LIFE SAFETY 101THE PROJECT IS A TENANT BUILD-OUT FOR ISLAND DONUTS.STANDING SPACE = 5 SQ. FT. PER PERSONNET. = 61SF / 5 SF= 13 PEOPLEKITCHEN = 200 SQ. FT. (FBC) 100 SQ. FT. (NFPA) PER PERSONNET. = 581 SF / 100 = 6 PEOPLE; 581 SF / 200 = 3 PEOPLE13 PEOPLETOTALSCALCULATIONS 25 PEOPLE06 PEOPLE1234SEATING ACTUAL = 25 PEOPLE01 PERSONWALK-IN + STORAGE = 300 SQ. FT. PER PERSONNET. = 92 SF / 300 SF= 1 PERSON13 PEOPLETOTALS 25 PEOPLE03 PEOPLE01 PERSON TOTAL OCCUPANT LOAD: 45 PEOPLEINDOOR SEATING = 15 SQ. FT. PER PERSONNET. = 595 SF / 15 SF= 40 PEOPLEFFPC/NFPA 101FBC 42 PEOPLE4 PERSON TABLES: 4 x 4 = 16 SEATSBAR STOOLS: 9 x 1 = 09 SEATSTENANT AREA:2,032 SF THE BUILDING IS NOT EQUIPPED WITH AN AUTOMATIC SPRINKLER SYSTEM.FLORIDA BUILDING CODE 7th EDITION (2020)FLORIDA BUILDING CODE - ACCESSIBILITY 7th EDITION (2020) FLORIDA FIRE PREVENTION CODE 7th EDITION (2020) (ENCOMPASSING THE 2018 EDITIONS OF NFPA 1 & NFPA 101)CONSTRUCTION: FBC SECTION 602.2 - TYPE IIB, UNPROTECTED, NON-SPRINKLEREDALLOWABLE HEIGHTS AND BUILDING AREAS: TABLE 504 - TYPE IIBALLOWABLE AREA (NS) - 23,000 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 3BUSINESS (B):OCCUPANCY CLASSIFICATION (FBC): BUSINESS (B) FBC 304.1; NFPA 3.3.40, 3.3.196.3 AND CHAPTER 38(NEW BUSINESS OCCUPANCIES). SECTION 302.1.1 SMALL BUILDINGS AND TENANT SPACES: A BUILDING OR TENANT SPACE USED FOR ASSEMBLY PURPOSES WITH AN OCCUPANT LOAD OF LESS THAN 50 PERSONS SHALL BE CLASSIFIED AS A GROUP B OCCUPANCY. OCCUPANCY CLASSIFICATION (FFPC): MERCANTILE (M) FBC 309.1; NFPA 3.3.182, 3.3.196.9 AND CHAPTER 36(NEW MERCANTILE OCCUPANCIES). ALLOWABLE AREA (NS) - 12500 SFMAX. HEIGHT (NS) - 55'-0"MAX. STORIES (NS) - 2MERCANTILE(M): A.3.3.196.9 MERCANTILE OCCUPANCY: OCCUPANCIES INCLUDE THE FOLLOWING: RESTAURANTS WITH FEWER THAN 50 PERSONS.TYPE IIB - TABLE FBC 601STRUCTURAL FRAMEINCLUDING COLUMNS, GIRDERS, TRUSSESBEARING WALLSEXTERIORINTERIORNONBEARING WALLS AND PARTITIONSEXTERIORNONBEARING WALLS AND PARTITIONSINTERIORFLOOR CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSROOF CONSTRUCTIONINCLUDING SUPPORTING BEAMS AND JOISTSBUILDING ELEMENT0TYPE IIB00000TYPE IIB - TABLE FBC 602OCCUPANT LOAD:MINIMUM OCCUPANT LOAD - NFPA TABLE 7.3.1.2 & 12.1.7:OFFICE: 150 GROSS SF PER PERSONCOMMERCIAL KITCHEN (PREP AREA & BAR): 100 GROSS SF PER PERSON (FFPC) OR 200 GROSS SF PER PERSON (FBC)STORAGE, STOCK, WALK-IN COOLER: 300 GROSS SF PER PERSONQUEUING AREA: 5 NET SF PER PERSONUNCONCENTRATED (TABLES AND CHAIRS) = 15 SQ. FT. PER PERSON < 5FIRE SEPARATION DISTANCE > 5< 10> 10< 30> 30(FT)TYPE OF CONSTRUCTIONOTHERSOTHERSIIBALLGROUP B1100GROUP M2100CLASS A INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 0-25; SMOKE DEVELOPED 0-450CLASS B INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 26-75; SMOKE DEVELOPED 0-450CLASS C INTERIOR WALL AND CEILING FINISH - FLAME SPREAD 76-200; SMOKE DEVELOPED 0-450MEANS OF EGRESS:OCCUPANCYMINIMUM AS REQUIRED BY FBC TABLE 803.11 (NON-SPRINKLERED):VERTICAL EXITSEXIT ACCESS CORRIDORSROOMS & ENCLOSED SPACESINTERIOR FINISHES:AS REQUIRED BY FFPC TABLE A.10.2.2:OCCUPANCYEXIT ACCESSOTHER SPACESMERCANTILEABCMERCANTILEA OR BA OR BA OR BVERTICAL EXITSEGRESS WIDTH PER PERSON SERVED:OTHER EGRESS COMPONENTS (CORRIDORS, RAMPS, ETC.) = 0.20" (FBC 10005.3.2)MINIMUM CLEAR WIDTH OPENING OF EXIT DOORS: 32" (32"/0.2" PER PERSON = 160 PERSONS)DOORS SHALL SWING IN THE DIRECTION OF EGRESS EXCEPT WHEN SERVING AN MINIMUM CORRIDOR AISLE WIDTH: 44" OCCUPANT LOAD OF LESS THAN 50 (FBC 1010.1.2.1)MAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): MERCANTILE - 200 FT FBC TABLES 1017.2 & 1020.4, & TABLE 1020.2:MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)MEANS OF EGRESS:NFPA 101 - 150 FT (MERCANTILE FFPC A.7.6)NFPA 101 - 20 FT (MERCANTILE FFPC A.7.6)MAXIMUM TRAVEL DISTANCE, DEAD END LENGTH, EXIT AND MEANS OF EGRESS WIDTH: COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (MERCANTILE) FFPC A.7.6CORRIDOR FIRE-RESISTANCE RATING (FBC TABLE 1020.1): GREATER THAN 30 OCCUPANTS w/o SPRINKLER SYSTEM - 10 (MERCANTILE - FFPC 36.3.6.1 EXCEPTION 1)(0.20" x 42 OCCUPANTS = 8.4" STAIR WIDTH REQUIRED)I OR IINABUSINESSABCBUSINESSA OR BA OR BA, B OR CMAXIMUM TRAVEL DISTANCE TO EXIT (NON-SPRINKLERED): BUSINESS - 200 FT NFPA 101 - 200 FT (BUSINESS FFPC A.7.6)MAXIMUM DEAD END CORRIDOR LENGTH (NON-SPRINKLERED): 20 FT (FBC 1020.4)NFPA 101 - 20 FT (BUSINESS FFPC A.7.6)COMMON PATH OF TRAVEL (NON-SPRINKLERED): 75 FT (FBC 1006.2.1);NFPA 101 - 75 FT (BUSINESS) FFPC A.7.61 (BUSINESS - FFPC 38.3.6.1)EXISTING 1 HR FIRE RATED DEMISING WALLPERSONS (P) DISCHARGING AT EXIT OR EXIT ACCESS,AND EGRESS CLEAR WIDTH (AT DOORS).INDICATES EXIT OR EXIT ACCESS, NUMBER OFSAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM TRAVEL DISTANCE TO AN EXTINGUISHER = 75 FTMAXIMUM FLOOR AREA PER 2A UNIT = 3,000 SFMAXIMUM FLOOR AREA PER EXTINGUISHER = 11,250 SFAND EGRESS CLEAR WIDTH (AT DOORS).SAMPLE EGRESS TRAVEL PATH AND DISTANCEMAXIMUM FLOOR AREA PER UNIT OF A = 1,500 SFFECSERIES CABINETS. CLEAR BUBBLE, BLACK LETTERS PROVIDE FIRELOCATED IN 2 1/2" ROLLED EDGE, SEMI-RECESSED, CAMEOFEC- FIRE EXTINGUISHER & CABINET FIRE EXTINGUISHERSCLASS A FIRES (ORDINARY COMBUSTIBLE MATERIALSSUCH AS WOOD, CLOTH, PAPER RUBBER AND MANY PLASTICS)CLASS B FIRES (LIQUIDS, TARS, OILS, GASES)CLASS C FIRES (ELECTRICAL EQUIPMENT)FIRE EXTINGUISHER TYPE "A" (UL RATING 3A-40B:C) 5 LB MULTIPURPOSE DRY CHEMICALEQUAL TO BADGER MODEL #5MB-6H (A KIDDE COMPANY)FIRE EXTINGUISHER TYPE "B" (UL RATING 2-A:K) 6 LITER (1.56 GAL) EXTINGUISHER FOR CLASS K FIRESEQUAL TO KITCHEN ONE MODEL #KS-6000 BY PYRO-CHEMCLASS K FIRES (COOKING MEDIA - VEGETABLE OR ANIMAL OIL AND FATS)FIRE EXTINGUISHERS SHALL BE CERTIFIED BY A LICENSE FIRE PROTECTION COMPANYWATER CLOSETS BUSINESS (B)21 MALES21 FEMALESTOTAL OCCUPANT LOAD BUSINESS - 42LAVATORIES1 LAV PER 100DRINKINGFOUNTAINS2 REQUIRED WATERCLOSET2 REQUIRED LAVATORIES1 WC PER 25 MALE/FEMALE FOR FIRST 50 AND 1 PER 80 FOR REMAINDER EXCEEDING 801 SERVICE SINKSERVICE SINK1 LAV PER 40 MALE/FEMALE FOR FIRST 80 AND 1 PER 50 FOR REMAINDER EXCEEDING 50PLUMBING FIXTURE COUNT PER TABLE 403.1 FLORIDA PLUMBING CODESEPARATE FACILITIES (FLORIDA PLUMBING CODE SECTION 403.2):EXCEPTION 04: SEPARATE FACILITIES SHALL NOT BE REQUIRED INBUSINESS OCCUPANCIES IN WHICH THE MAXIMUM OCCUPANT LOAD IS 25 OR FEWER.3"-4"31 2"RECESSED REMOTE FIRE PROTECTIONPULL STATION DETAILBOX AND CONDUIT INSTALLED AND SECURED BY ELECTRICAL CONTRACTORFIRE SYSTEM INSTALLATION SHALL BE BY AUTHORIZED ANSUL DISTRIBUTORREMOTE FIRE SYSTEM PULLDETAIL RFP-1PULL08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CODE DATA G-1ARCHITECTURALMECHANICALPLUMBINGPLUMBING LEGEND AND PROJECT NOTESP-1ELECTRICALPLUMBING SCHEDULESP-2PLUMBING PLANSP-3DOMESTIC WATER PLANP-4PLUMBING GAS PLAN AND GAS RISERP-5M-1 MECHANICAL NOTES, LEGEND AND ABBREVIATIONSM-2 MECHANICAL SCHEDULESM-3 MECHANICAL PLANM-4 MECHANICAL DETAILSG-1 CODE DATAG-2 LIFE SAFETY PLANA-1 EXISTING FLOOR PLANA-1.1 DEMOLITION FLOOR PLANA-2 FLOOR PLAN & GENERAL NOTESA-2.1 WALL FINISH PLANA-2.2 FLOOR FINISH PLANA-2.3 ROOF PLANA-2.4 EQUIPMENT SCHEDULEA-3 EXISTING REFLECTED CEILING PLANA-3.1 REFLECTED CEILING PLANA-4 ENLARGED TOILET ROOM PLANA-4.1 DOOR & HARDWARE SCHEDULEA-5 INTERIOR ELEVATIONSA-5.1 INTERIOR ELEVATIONSA-5.2 INTERIOR ELEVATIONSA-6 ACCESSIBILITY GUIDELINESPLUMBING DETAILSP-6SANITARY RISERSP-7E-1 POWER PLANE-2 LIGHTING PLANSCALE: N.T.SSITE MAPPROJECT SITEPLUMBING SCHEDULESP-2.1PLUMBING DETAILSP-6.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"17" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK160P32"NOTE A160P32"NOTE A160P32"NOTE A160P32"NOTE AEXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 EXISTING 1-HOUR FIRE RATED TENANT SEPARATION WALL PER UL DESIGN U419 29'26'25'33'FEFEFENOTE A:EXIT DOOR TACTILESIGNAGE READING:EXITSIGNAGE SHALLCOMPLY w/ANSI/CABOA117.1; MOUNT 60" AFFTO CENTERLINE OF SIGNDOORS NOT REQUIRING SPECIAL TOOLSLOCKS ON EXIT DOORS SHALL NOT REQUIRETHE USE OF A KEY, A TOOLOR SPECIAL KNOWLEDGE OR EFFORTFOR OPERATION FOR OPERATION FROMEGRESS SIDE UNLESS THEY MEET THEREQUIREMENTS OF NFPA 101 7.2.1.5.ON THE TENANT'S SUITE. LETTERS PROVIDE MIN 6" HIGH LETTERSTHE STREET THEREFORE THE ADDRESS NUMBER MUST BE VISIBLE & LEGIBLE FROM MAY NEED TO BE LARGER THAN THE MINIMUMOF 6" - COORD w/ FIRE MARSHAL315 SF PERPERSON25 PEOPLE595 SF5 SF PER PERSON13 PEOPLE61 SF12581 SF200 SF PERPERSON (FBC)3 PEOPLE100 SF PERPERSON (FFPC)6 PEOPLE4300 SF PERPERSON1 PEOPLE92 SFE1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"16" DEEP COUNTERGRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERTHREE COMPARTMENT SINK234408-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 LIFE SAFETY PLANSCALE:1/4":1'0"LIFE SAFETY PLANG-2SCALE:1/4":1'0"OCCUPANCY CALCULATIONS K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHU08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING FLOOR PLANA-1 K-1728CHESAPEAKEC_LAVATORYVITREOUS CHINA AHUREMOVE EXISTINGWALLSREMOVE EXISTINGOVERHEADREMOVE EXISTINGWALLSREMOVE EXISTINGWALLSREMOVEEXIST.PLUMBINGFIXT.REMOVEEXIST. DOOR& MILLWORKREMOVE EXISTINGWALLS07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DEMOLITION PLANSCALE:1/4":1'0"DEMOLITION PLANA-1.1 E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER101101A103107108109101B10501*01010101020202010101*01*33214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242550101011828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.17" DEEP COUNTER10. DIMENSIONS NOTED AS "CLEAR" ARE FROM FACE OF GYPSUM WALLBOARD TO GYPSUM WALLBOARD.GENERAL NOTES3. THIS BUILDING WILL BE A NONSMOKING FACILITY.4. ALL WORK SHALL BE IN COMPLIANCE WITH THE BUILDING CODES, RECOGNIZED INDUSTRY STANDARDS, CRAFTSMANSHIP STANDARDSIN THE AREA, AND ALL MANUFACTURER'S RECOMMENDATIONS.5. THERE SHALL BE A FLOOR OR LANDING ON EACH SIDE OF A DOOR. SUCH FLOOR OR LANDING SHALL BE AT THE SAME ELEVATION ON EACH SIDE OF THE DOOR. LANDINGS SHALL BE LEVEL EXCEPT FOR EXTERIOR LANDINGS WHICH ARE PERMITTED TO HAVE A SLOPE NOT TO EXCEED 0.25 UNIT 6. FIELD VERIFY ALL DIMENSIONS AND EXISTING CONDITIONS PRIOR TO CONSTRUCTION. REPORT ANY AND ALL DISCREPANCIES TO THE ARCHITECT/ENGINEER.8. CONTRACTOR SHALL PERMANENTLY IDENTIFY ALL FIRE-RESISTANT-RATED WALLS (AND CORRESPONDING FIRE-RESISTANT RATINGS)INCLUDING FIRE BARRIER WALLS, SMOKE BARRIER WALLS, FIRE PARTITIONS, FIRE WALLS, AND SHAFT ENCLOSURES EITHER BYINSTALLING SIGNS OR BY STENCILING IN CONCEALED SPACES THE FOLLOWING: ( ) HOUR FIRE AND SMOKE RATED BARRIER -PROTECT ALL OPENINGS. IDENTIFICATION SHALL BE SPACED NO MORE THAN TWELVE (12) FEET ON CENTER WITH A MINIMUMLETTER SIZE OF TWO (2) INCHES IN HEIGHT ON A CONTRASTING BACKGROUND9. DO NOT SCALE DRAFTING, REPORT ERRORS IN DIMENSIONING TO ARCHITECT BEFORE PROCEEDING WITH WORK.2. SELF CLOSING DEVICES SHALL BE PROVIDED ON DOORS IN A MEANS OF EGRESS AND SHALL MEET THE REQUIREMENTS OF THENFPA LIFE SAFETY CODE 101 (2018) CHAPTER 7.2.1.8 AND THE FLORIDA FIRE PREVENTION CODE 7th EDITION.1. SWING & FORCED OPEN DOORS SHALL MEET THE REQUIREMENTS OF NFPA LIFE SAFETY CODE AS FOUND IN THE FLORIDA FIRE PREVENTION CODE 6th EDITION CHAPTER 7.2.1.4 AND THE FLORIDA BUILDING CODE 7th EDITION (2020) 1008.1.2.VERTICAL IN 12 UNITS HORIZONTAL (2% SLOPE). FBC 1010.1.57. THE GENERAL CONTRACTOR SHALL PROVIDE FLORIDA PRODUCT APPROVAL NOTICES ON ALL REQUIRED COMPONENTS AND CLADDING.11. PLANS FOR FIRE-PROTECTION SPRINKLER SYSTEM (NOT PROVIDED BY DSAE), INCLUDING SUPPORT DETAILS, SHALL BEREVIEWED AND APPROVED BY THE LOCAL AUTHORITY PRIOR TO INSTALLATION FOR COMPLIANCE WITH THE FLORIDA BUILDING CODE7th EDITION (2020) AND NFPA 13 (LATEST EDITION).1. THE CONTRACTOR SHALL VISIT, BEFORE SUBMITTING PRICES. GENERAL NOTES - FINISHES2. ALL INTERIOR DOOR FRAMES SHALL BE PAINTED.3. ALL INTERIOR PARTITIONS SHALL RECEIVE TWO COATS OF SHERWIN WILLIAMSSEMI-GLOSS PAINT OVER ONE COAT OF PRIMER UNLESS OTHERWISENOTED. 4. ALL HORIZONTAL GYPSUM BOARD SURFACES SHALL BE PRIMED WITHFLAT WHITE FINISH, UNLESS OTHERWISE INDICATED.5. FLOOR TRANSITIONS SHALL OCCUR AT THE CENTERLINE OF DOORS. SUBMIT SAMPLES FOR OWNER'S SELECTION PRIOR TO INSTALLATION.6. CENTER FLOOR TILES IN ROOM, UNLESS OTHERWISE NOTED.7. ALL LEFT OVER PAINT SHALL BE CLEARLY LABELED AND APPROPRIATELYPACKAGED. CONTRACTOR SHALL DELIVER ALL LEFTOVER PAINT AND FINISHMATERIALS TO TENANT FOR STORAGE.8. ALL INTERIOR FINISHES TO BE THE MINIMUM CLASSIFICATION AS LISTED ON THECODE DATA SHEET.NOTES:1. MEASURING 8" HORIZONTALLY AND 8 INCHES VERTICALLY, OF A BRIGHT RED REFLECTIVE COLOR.2. THE SYMBOL SHALL BE PLACED WITHIN 24" TO THE LEFT OF THE MAIN ENTRY DOOR .3. BE PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE ON ACONTRASTING BACKGROUND.4. BE MOUNTED ON A CONTRASTING BASE MATERIAL WHICH IS THEN PERMANENTLY ATTACHED TO THE FACE OF THE STRUCTURE.5.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR FINISHED FLOOR TO THE BOTTOM OF THE SYMBOL SHALL NOT BE LESS THEN 4FEET (48").6.THE DISTANCE ABOVE GRADE, WALKING SURFACE OR THE FINISHEDFLOOR TO THE TOP OF THE SYMBOL SHALL BE NOT MORE THAN 6' (72 IN.)8"8"07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR PLANSCALE:1/4":1'0"FLOOR PLANA-2NOTESINSULATIONTYPEWALL TYPE SCHEDULEDESCRIPTION2. EXPOSED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 25 ANDA SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.3. CONCEALED INSULATION MATERIALS INSTALLED SHALL HAVE A FLAME SPREAD RATING OF NOT MORE THAN 75 AND A SMOKE DEVELOPED RATING OF NOT MORE THAN 450 AS DETERMINED IN ACCORDANCE WITH ASTM E 84.NOTES:5. PROVIDE WOOD BLOCKING AS REQUIRED TO SUPPORT TOILET ROOM FIXTURES, ACCESSORIES, SHELVES & CABINETS, FIRE EXTINGUISHERS, ETC. WOOD BLOCKING IN FIRE-RATED WALLS SHALL BE FIRE-RATED. 6. PROVIDE R-11 SOUND ATTENUATION BATT AROUND THE TOILET ROOMS.1. PROVIDE FIREBLOCKING AND DRAFTSTOPPING IN PARTITIONS PER FBC 717. PROVIDE FIREBLOCKING IN CONCEALED WALL SPACES INCLUDING VERTICALLY AT THE CEILING AND FLOOR LEVELS AND HORIZONTALLY AT INTERVALS NOT EXCEEDING 10' (FBC 717.2.2). SEE FBC 717.2.1 FOR FIREBLOCKING MATERIAL OPTIONS.COMBUSTIBLE WOOD BLOCKING IN NON FIRE-RATED WALLS IS PERMITTED 4. PROVIDE WATER RESISTANT GYPSUM BOARD AROUND PLUMBING FIXTURES AND WALLS TO RECEIVE CERAMIC TILEEQUAL TO USG'S FIBEROCK'S BRAND AQUA-TOUGH INTERIOR PANELS. GYPSUM WALLBOARD PRODUCTS MUST BE RATED FOR WET LOCATIONS IN ACCORDANCE WITH THE TILE COUNCIL OF NORTH AMERICA (TCNA) HANDBOOK. GREEN BOARD IS NOTAPPROVED FOR TOILET ROOM LOCATIONS.133 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON EACH SIDE; EXTEND WALL 6" ABOVE THER-11NEW 3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE; EXTEND WALL 6" ABOVE THER-132NEW 6", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDR-133/8" AIR GAP FROM EXISTING CMU WALLADJACENT CEILINGADJACENT CEILING1/2" AIR GAP FROM EXISTING CMU WALLON ROOM SIDE; EXTEND WALL 6" ABOVE THEADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/240BRACE WALL TO LIMIT DEFLECTION TO L/2401*3 5/8", 20 GA. METAL STUDS @ 24" O.C. WITHONE LAYER OF 1/2" GYPSUM WALLBOARDON ROOM SIDE AND 1/2" PLYWOOD ON KITCHEN SIDER-11EXTEND WALL 6" ABOVE THE ADJACENT CEILINGBRACE WALL TO LIMIT DEFLECTION TO L/240 ROOM FINISH SCHEDULESEATING AREAFLOORBASEWALLSCEILINGCEILINGHEIGHTREMARKS101RSRESILIENT WALL BASEVCTVINYL COMPOSITION TILEACTACOUSTICAL CEILING TILES/SSTAINLESS STEEL PANELS====PTPAINT=FRPFIBERGLASS REINFORCED PANEL=CTCERAMIC TILE=SCSTAINED CONCRETE=EPEPOXY PAINT=QTQUARRY TILE=107WOMEN'S TOILET ROOMROOM NAMEPROVIDE MOISTURE RESISTANT GYPSUM WALLBOARD (ASTM C630/630M) IN WASH DOWN AND WET AREAS; COORD w/OWNER'S REPACOUSTICAL CEILINGS SHALL COMPLY w/ THE FOLLOWING: ASTM C635, ASTM C636, ASTM C665, ASTM E580, ASTM C1284 AND CEILINGS AND GYPSUM BOARD:PROVIDE TILE BACKER BOARD (DEN-SHIELD OR APPROVED EQUAL) ON WALLS TO RECEIVE CERAMIC TILE (ASTM C1178)PROVIDE FIRE RATED GYPSUM BOARD TYPE "X" 5/8" THICK ON FIRE RATED PARTITION (ASTM C36) INSTALLED PER UL ASSEMBLY REQUIREMENTSACOUSTICAL CEILING TILES:PROVIDE ACOUSTIC INSULATION (ASTM C665) AROUND ALL TOILET AND BATHROOMS AND AS NOTED ON THE WALL TYPE SCHEDULE. INSULATION INSULATION:SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED R-11 MIN.PROVIDE BATT INSULATION (ASTM C665) IN EXTERIOR WALLS AND SOFFIT AREAS WITH R-VALUES AS NOTED ON PLANS AND SECTIONS. BATT INSULATION SHALL BE PREFORMED GLASS FIBER, FRICTION FIT UNFACED.INSULATION SHALL HAVE FLAME/SMOKE PROPERTIES 75/450 IN ACCORDANCE WITH ASTM E84STUDS AND TRACKS (ASTM C645, GA-216, GA-600) SHALL BE GALVANIZED SHEET STEEL, 0.0188" THICK (25 GA), 0.284 (22 GA), 0.0359 (20 GA); FRAMING MATERIALS:ANCHOR TO SUBSTRATE WITH TIE WIRES, NAILS, SCREWS, AND OTHER METAL SUPPORTS, OF TYPE AND SIZE TO SUIT APPLICATION TO RIGIDLY METAL STUD INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: MAXIMUM DEFLECTION OF INTERIOR NON-LOAD BEARING PARTITIONS SHALL BE L/240 AT 5 PSF. PROVIDE LATERAL REINFORCING CEILING FRAMING INSTALLATION: INSTALLED IN ACCORDANCE WITH ASTM C754, GA-216 & GA-600DEFLECTION: LEVEL CEILING TO A TOLERANCE OF L/600. LATERALLY BRACE ENTIRE SUSPENSION SYSTEM.GYPSUM BOARD INSTALLATION: INSTALLPER GA-216 & GA-600. ERECT EXTERIOR GYPSUM SHEATHING IN ACCORDANCE WITH ASTM C1280.PROVIDE A GYPSUM BOARD ACCESSORIES AS REQUIRED : ACOUSTIC SEALANT, CORNER BEADS, EDGE TRIM (GA-216), JOINT MATERIALS (ASTM C475 & GA-216) - REINFORCING TAPE, JOINT COMPOUND, ADHESIVE & WATER.GYPSUM BOARD FINISHES:LEVEL 1 - ABOVE FINISHED CEILINGS CONCEALED FROM VIEWLEVEL 2 - WALLS BEHIND CABINETRYLEVEL 3 - WALLS EXPOSED TO VIEWLEVEL 4 - CEILING EXPOSED TO VIEWLEVEL 5 - SPECIAL WALLS TO RECEIVE WRITING SURFACES, PAINTED MURALS, OR PROJECTION SCREENS.INTERIOR SYSTEMS CONSTRUCTION ASSOCIATION.INSTALLATION: INSTALL LAY-IN CEILING IN ACCORDANCE WITH ASTM C636 AND ASTM E580. INSTALL SYSTEM CAPABLE OF SUPPORTING IMPOSED LOADS TO DEFLECTION OF L/360 MAXIMUMACCESSORIES: PROVIDE ALL NECESSARY ACCESSORIES; GALVANIZED SUPPORT HANGERS AND CHANNELS, PERIMETER MOLDINGS (SAME MATERIAL AND FINISH AS THE GRID - L-SHAPED MOLDING FOR MOUNTING AT THE SAME ELEVATION AS FACE OF GRID)TOUCH UP PAINT AS REQUIRED TO MATCH GRID.INSTALL TILE PER THE TCA (TILE COUNCIL OF AMERICA) HANDBOOK FOR TILE INSTALLATION.CERAMIC AND QUARRY TILESECURE MATERIALS IN PLACE.AS REQUIREDNOTE:ALL FINISHES AND COLORS SHALL BE APPROVED BY OWNER PRIOR TO ORDERINGFINISHES:C-SHAPE, WITH KNURLED FACES.VINYL COMPOSITION TILE (VCT):VCT EQUAL TO ARMSTRONG STANDARD EXCELON SERIES; 12" x 12" x 1/8"1.1PERFORMANCE REQUIREMENTSA.Conform to applicable code for fire performance ratings as follows:1.Flooring, critical radiant flux (CRF): Minimum 0.45 watt per square centimeter, per ASTM E 648.2.Flooring, smoke developed: Maximum 450, per ASTM E662.3.Class 2 finish per ASTM F1066ORDER COUNTER102OFFICE103CONDIMENT AREA104KITCHEN/PREP/DW105WALK-IN COOLER106MEN'S TOILET ROOM108JAN CLOSET1092x2 SUSPENDED VINYLACOUSTICAL TILE & GRIDVBVINYL BASE=ALALUMINUM= (COORDINATE ANY LOCATIONS OF LEVEL 5 FINISH WALLS w/OWNER AND ARCHITECT PRIOR TO BIDDING)SCCTSCSCSCQTQTCTSCHEXAGON FLOOR TILESHEXAGON FLOOR TILESFRP/SS/PWADTPEP/CTEP/CTPWPLYWOOD=QTQT--------------VINYL ACTACTACTACTACTACTACTACT10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"10'-0"SHIP LAP WALL SIDINGPTPTPTPTPT8'-0"ADTP4" INSULATED CEILING PANELSHIP LAP WALL SIDINGSHIP LAP WALL SIDINGWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105SUBWAY TILE (CT)PLYWOOD (PW)WALL FINISH LEGENDPAINT (PT)FIBERGLASSREINFORCEDPANEL (FRP)STAINLESS STEEL(SS)PLYWOOD(PW)BLOCKINGW/FRP WALLFINISHPAINT,TYP.STAINLESSSTEEL, TYP.SUBWAYTILE(CT)SUBWAYTILE(CT)FIBERGLASSREINFORCEDPANEL, TYP.PAINT,TYP.PLYWOOD(PW) BLOCKINGw/FRP WALLFINISHPLYWOOD(PW)BLOCKINGw/FRP WALLFINISHSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDINGSHIP LAP SIDING ONTOP AND BOTTOM OFWINDOWS, TYP.STAINLESSSTEEL, TYP.FRPSTAINLESSSTEELWRAPPEDOPENINGFRP WRAPPEDOPENING07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 WALL FINISH PLAN AND ROOM FINISH SCHEDULE A-2.1SCALE:1/4":1'0"WALL FINISH PLAN WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104ELECTRICALPANELELECTRICALPANELKITCHEN/PREP/DW105QUARRY TILE(QT)STAINED CONCRETE(SC)FLOOR FINISH LEGENDHEXAGONALFLOOR TILE(CT)07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 FLOOR FINISH PLAN A-2.2SCALE:1/4":1'0"FLOOR FINISH PLAN EXISTING TENANTSEPARATION FIRE WALLKITCHEN HOODBELOWEXISTING TENANTSEPARATION FIRE WALLCU-2CU-1PROVIDE LANDLORD APPROVEDCONDENSATE STANDS FORWALK-IN-COOLER & FREEZERCONDENSERSPROVIDE PERMANENT FALLARREST/RESTRAINT ANCHORAGECONNECTOR DEVICESCOMPLYING w/ANSI/ASSE Z 359PER FMC 304.11 EXCEPTION07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ROOF PLAN A-2.3SCALE:1/4":1'0"ROOF PLAN E1 RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKPOSWALL-MOUNTEDHAND SINKPOSDECK MOUNTWATERSTATIONGLAZERSHELVING UNIT18"x36"SHELVING UNIT12"x48" PROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLE DONUT FRYERDONUT DEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEUTILITYCABINET.EXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUWALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CONDIMENT BARCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKER3214THREE COMPARTMENT SINK56788859101112131415161719212223232323262724242551828292030CLOSER PANEL & SEALANTBETWEEN WALL & W.I.C,TYP.17" DEEP COUNTER07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULESCALE:1/4":1'0"EQUIPMENT PLANA-2.4 07-12-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EQUIPMENT SCHEDULE A-2.5 WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104NOTE A:EXHAUST HOOD SYSTEMBELOW; FIT ACOUSTICALCEILING AROUND EXHAUSTHOOD; PROVIDE STAINLESSSTEEL CLOSURE PANELBETWEEN EXHAUST HOOD &ACOUSTICAL CEILINGNOTE AFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF FFFFFFFF FFFF FFFF FFFF FFFF GYP. BD. & METAL STUDBULKHEAD @ 9'-6"BOTTOM OFSOFFIT @9'-7"FFFFFFFF 2x2 SUSPENDED ACOUSTICAL VINYL FACEDTILE & GRIDRECESSED CEILINGFIXTUREEMERGENCY EXIT LIGHTEXIT SIGN2 x 2 SUPPLY DIFFUSERGYPSUM WALLBOARD SOFFITCEILINGPENDANT FIXTURE2 x 4 LIGHT FIXTURE2 x 2 LIGHT FIXTUREEMERGENCYLIGHT2 x 2 RETURN AIREXHAUSTFANTRACK LIGHTINGw/PENDANTSWALLSCONCEFFFF FFFF EXH FANVINYL ACOUSTICAL CEILING TILE2 x 4 LIGHT FIXTURE w/BATTERY BACKUPFFFF 08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 REFLECTED CEILING PLANSCALE:1/4":1'0"REFLECTED CEILING PLANA-3.1 ATTIC ACCESSREMOVE EXISTING SOFFIT.BOTTOM OF SOFFIT @ 7'-10"REMOVE EXISTING DUCTREMOVE EXISTINGDUCTLESS HVAC UNITREMOVE EXISTING AIRHANDLER UNITREMOVE EXISTING LIGHTS,TYP.REMOVE EXISTING LIGHTS,TYP.REMOVE EXISTINGDIFFUSERS & DUCTS, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.REMOVE EXISTINGACOUSTICAL CEILING TILE &GRID, TYP.EXISTING SLOPINGACOUSTICAL CEILING TILE &GRIDREMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.REMOVE ALL EXISTINGCONDUITS MOUNTED TOTHE CEILINGS, TYP.EXH FANACOUSTICAL CEILINGHEIGHT: 9'-10 58"GYP BOARD CEILINGHEIGHT ABOVE ACT: 11'-10 58"ACOUSTICAL CEILINGHEIGHT: 7'-4 18"ACOUSTICAL CEILINGHEIGHT: 9'-0"BOTTOM OF GYP BOARDCEILING 11'-9 78"REMOVE EXISTING EXITSIGNS, TYP.08-23-22ISLAND DONUTS TENANT BUILD-OUTSHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 EXISTING FLOOR PLANSCALE:1/4":1'0"EXISTING REFLECTED CEILING PLANA-3 A-41243MEN'STOILET ROOM108A-456WOMEN'STOILET ROOM10708-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ETR PLAN & ELEVATIONS SCALE:1/2":1'0"ENLARGED TOILET ROOM PLANA-4SCALE:1/2":1'0"ELEVATION 01SCALE:1/2":1'0"ELEVATION 02SCALE:1/2":1'0"ELEVATION 03SCALE:1/2":1'0"ELEVATION 04SCALE:1/2":1'0"ELEVATION 05SCALE:1/2":1'0"ELEVATION 06TOILET ACCESSORY LEGENDNOTES1. HANDICAPPED ACCESS MOUNTINGDIMENSIONS ARE VERY CRITICALACCESSORIES TO BE IN ACCORDANCEMOUNTING LOCATION OF TOILETAND HAVE NO MINUS TOLERANCES.WITH A.D.A. TITLE III & FLORIDABUILDING CODE 7th EDITION (2020) -ACCESSIBILITY.WHERE THE TOILET IS FOR INDIVIDUAL USE AND CLEAR FLOOR SPACE COMPLYING WITHFBC-ACCESS 305.3 (A 30"x48" SPACE) IS PROVIDED WITHIN THE ROOM BEYOND THEARC OF THE DOOR SWING, DOORS SHALL BE PERMITTED TO SWING INTO THE CLEARFLOOR SPACE OR CLEARANCE REQUIRED FOR ANY FIXTURE (FBC-ACCESS 603.2.3 EXCEPTION 2)WHERE THE SPACE BENEATH AN ELEMENT IS INCLUDED AS PART OF THE CLEARFLOOR OR GROUND SPACE, THE SPACE SHALL COMPLY WITH FBC-ACCESSIBILITY306 FOR KNEE & TOE CLEARANCETHE SPACE BENEATH THE SINK COMPLIES WITH THIS REQUIREMENT FACE OF FINISH. FINISH THICKNESS 2. ALL DIMENSIONS SHOWN ARE FROM MUST BE ADDED TO ANY ROUGH IN DIMENSIONS.SURFACE MTD. SOAP DISPENSERDOUBLE TOILET PAPER HOLDERTOWEL DISPENSERSURFACE MTD. PAPERHANDICAPPED GRAB BAR24 x 36 MIRRORBASIS OF DESIGNCSI BATHWARE BAR-SB36-TW-125-MBBASIS OF DESIGNSUNERA BLACK PAPER TOWEL DISPENSERBASIS OF DESIGNNXHOME RECTANGULARw/ROUNDED CORNERSNotes: (Typical for All Signs)1.6" MIN HIGH BORDER DIMENSION ~ TACTILE MALE/FEMALE FIGURES.2.THE USE OF THE MALE/FEMALE TACTILE CARICATURES AREREQUIRED.3.LETTERS, NUMERALS, BRAILLE LETTERS AND PICTORIAL SYMBOLSSHALL BE RAISED 132" FROM THE BACKGROUND AND SHALL BE 58"MINIMUM TO 2" MAXIMUM IN HEIGHT.4.BRAILLE LETTERS SHALL BE RAISED IN GRADE 2 BRAILLE.5.CHARACTER PROPORTION AND HEIGHT TO w/ ANSI A117.1 SECTION703.6.COLOR CONTRAST SHALL COMPLY W/ ANSI A117.1 SECTION 703.3.12.7.THE SIGN HORIZONTAL CENTERLINE SHALL BE @ 60" AFF.8.THE SIGN LOCATION SHALL BE LOCATED ON THE WALL ORPARTITION TO THE STRIKE JAMB/LATCH SIDE OF THE DOOR.9.ALL SPECIFICATIONS FOR SIGNAGE MUST COMPLY W/ ICCA117.1-2009 CHAPTER 7, COMMUNICATION ELEMENTS ANDFEATURES.WOMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANTWOMEN'S RESTROOM SIGNS WITH TACTILE TEXT AND GRADE 2 BRAILLEWomens Restroom Braille ADA Signs - 6" x 8"ADA-1020; Color - White on BlueMEN'S RESTROOM SIGN EQUAL TO ADA SIGN DEPOT - ADA COMPLIANT MEN'SRESTROOM SIGN WITH TACTILE TEXT AND BRAILLEMens Restroom Braille ADA Signs - 6" x 8"ADA-1021; Color - White on BlueBASIS OF DESIGNBGL TOILET PAPER HOLDER - BLACK STAINLESS BASIS OF DESIGNWEWBABY 27ozMATTE BLACK3. ALL TOILET ACCESSORIES SHALL BE(WELDED FRAME)STRAIGHT GRAB BAR, 36", MATTE BLACKCSI BATHWARE BAR-SB48-TW-125-MB STRAIGHT GRAB BAR, 48", MATTE BLACKSTEEL FINISH TOILET PAPER ROLL HOLDER WITH SHELF WALL MOUNTED FOR BATHROOM(BLACK, DOUBLE HEAD)400 C-FOLD / 525 MULTI-FOLD PAPER TOWEL *DIAPER CHANGING STATION MODEL - Koala Kare KB200-SS Horizontal Wall MountedBaby Changing Station / Table GREY 01 color TO OPERATE. LEVER-OPERATED MECHANISMS ARE ACCEPTABLE DESIGNS.HAND AND DOES NOT REQUIRE TIGHT GRASPING, TIGHT PINCHING, OR TWISTING OF THE WRISTOPERATING LEVER ON DOOR SHALL HAVE A SHAPE THAT IS EASY TO GRASP WITH ONE2. PROVIDE LEVER TYPE COMMERCIAL (ANSI A156.2, 1996, SERIES 4000, GRADE 1 )1. ALL INTERIOR DOORS TO BE FLUSH SOLID CORE WOOD DOORS (BIRCH), GRADE DOOR HARDWARE (ANSI A117.1 COMPLIANT).DOORS AND HARDWARE3'-0" x 7'-0" x 1 3/4" - PAINT FINISH. FRAMES SHALL BE PAINTED4. COORDINATE ALL KEYING & LOCKSETS WITH TENANT.STEEL (WELDED OR KNOCK-DOWN) - COORDINATE w/TENANT.1 1/2 PR BUTT HINGES3 DOOR SILENCERSPRIVACY LOCKSETANSI F76 BED/BATH PRIVACY LOCK; PUSH-BUTTON LOCKING. TURNING INSIDE LEVER RELEASES PUSH-BUTTON. CAN OPEN FROM OUTSIDE VIA EMERGENCY RELEASE1 WALL STOP3. ALL EXTERIOR DOORS & DOORS SHALL BE GALVANIZED, INSULATED (R-7) METAL DOORS w/GALVANIZEDMETAL FRAMES.DOOR: Level 1 - Standard-duty, Model 1, nominal 20 gage/0.032 inch (0.8 mm) face sheets, 1 3/4", full flush designDOOR FRAMES: Level 1 for Door Models 1, nominal 18 gage/0.042 inch (1.0 mm) thick material, base metal thickness.HARDWARE GROUP 1HARDWARE GROUP 21 OFFICE LOCKSET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F82 KEY OPENS LOCK FROM OUTSIDE,PUSH-BUTTON LOCKING FROM INSIDE,LATCH TURNING INSIDE RETRACTS LOCK1 WALL STOPHARDWARE GROUP 31 PASSAGE SET1 1/2 PR BUTT HINGES3 DOOR SILENCERS1 DOOR CLOSERANSI F75 BOTH LEVERS ALWAYS UNLOCKED1 WALL STOPWDWOOD=STLSTEEL=MTLMETAL=AL/GLALUMINUM/GLASS=DOOR SCHEDULEMARKLOCATIONTYPESIZEMATLGLAZINGLOUVERDOORSMATLTYPEGRPHDWLBL/RTGFRAMESREMARKS101ENTRANCEFG--ALAL/GL103OFFICEKITCHEN/DW105108MEN'S TOILET 3'0" x 7'0" x 1 3/4"--MTLWD3'0" x 7'0" x 1 3/4"--107WD1WOMEN'S TOILET1--MTLAL/GL----FFEXISTING DOOR & EXISTING HARDWARE TO REMAIN3'0" x 7'0" x 1 3/4"101AENTRANCEFG--ALAL/GL--AL/GL 3'0" x 7'0" x 1 3/4"EXISTING DOOR & EXISTING HARDWARE TO REMAINEXISTING DOOR & EXISTING HARDWARE TO REMAINF 3'0" x 7'0" x 1 3/4"--WD2MTL3'0" x 7'0" x 1 3/4"C----ALHM--EXISTING DOOR & EXISTING HARDWARE TO REMAIN109JAN CLOSETF 3'0" x 7'0" x 1 3/4"--WD3MTL101BEXIT3'0" x 7'0" x 1 3/4"C----ALHM--DOOR TYPES43" MAX 10" MIN STL. FRAMECAULK (BOTH SIDES -SEE SCHED. DOOR HGT./WIDTH STUD PARTITION2"G.W.B. & MTL.ALL AROUND)BACKBEND RETURNBARRIER-FREE CYLINDRICALLEVER SET DESIGNBARRIER-FREE CYLINDRICALLEVER SET DESIGN08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 DOOR & HARDWARE SCHEDULE A-4.1 E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104101101A103107108109101B10501A-602A-603A-604A-607A-6.108A-6.105A-6.106A-6.110A-6.1RACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETRACK SPECSKLINGER'S SHEETTHREE COMPARTMENT SINKPLANETARY MIXERICING GLAZINGEQUIPMENT, 4 BOWLDOUGHNUT DISPLAY RACKWALL-MOUNTEDHAND SINKDECK MOUNTWATERSTATIONGLAZERPROOFER CABINET SHEETER WOOD TOP BAKERS TABLEPREPARATION TABLEDONUT FRYERDONUTDEPOSITOR COFFEECONVEYOR TOASTERS/S TABLES/S PREP TABLE 30" x 60" 30" X 48"GRIDDLE60"REFRIGERATEDCHEF'S BASEEXHAUSTHOODFLOOR MOP SINKWALL-MOUNTEDHANDSINKS/S TABLE30" x 48"PASS THRUCOFFEE STATIONS/SSTAGING TABLE30" x 30"GRAB-N-GO CASESELF-SERVE U/C CASESTRUCTURAL CONCEPTSCO33R-UC-E3U/C REFw/GLASS DOORELECTRICALPANELELECTRICALPANELBOXSTORAGEWALL-MOUNTEDHAND SINK30"x36"U/C ICE MAKERCONDIMENT BAR17" DEEP COUNTER10'-0"SHIP LAP SIDINGHANDSINKWATERSTATIONBOXSTORAGE10'-0" 11'-93 4"COFFEESTATIONSSHIP LAPSIDINGGRAB-N-GO CASESELF-SERVE U/C CASEDONUTS DISPLAYRACK BY OWNERCOFFEE STATION10'-0"WRAP OPENINGw/STAINLESS STEELFACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLES IN WOODw/ PLASTER & LIME WASHSHIP LAPSIDING2'-10"1'-6"4'-0" 10'-0" 11'-93 4"FACE OF CABINET & COUNTERWHITE WASH PECKY CYRESSWOOD ( FILL IN HOLESIN WOODw/ PLASTER & LIME WASHSHIP LAP SIDING08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONSSCALE:1/4":1'0"KEY PLANA-5SCALE:1/4":1'0"ELEVATION01SCALE:1/4":1'0"ELEVATION02SCALE:1/4":1'0"ELEVATION03SCALE:1/4":1'0"ELEVATION04 KLINGER'S SHEETRACK SPECSWOOD TOPBAKERS TABLE7'-0"2'-10"10"1'-6"10'-0" 6'-8"SHIP LAPSIDING11'-1014"STAINLESS STEELCLOSURE PANELFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRP2" STAINLESS STEELWRAP AROUNDOPENINGSTAINLESSSTEEL SHELFHANDSINKCONVEYORTOASTER60" REFRIGERATEDCHEF'S BASEGRIDDLEDOUGHNUTFRYER10'-0" 11'-93 4"KITCHEN/PREP/DW105OFFICE103STAINLESS STEELWALL PANELSSHIP LAPSIDINGPROVIDE 14 GA STEELBACKINGDONUT DEPOSITOR MOUNT ARM 38"AFF/7" OFF FRYER'S EDGE; COORDINSTALLATION W/TENANT;PROVIDE STEEL BLOCKINGDOUGHNUTFRYERHANDSINKTHREECOMPARTMENTSINK10'-0"11'-934"FIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPFRPSTAINLESS STEELWALL PANELSFIRE-RATEDTENANTSEPARATION WALLVINYL-FACED ACOUSTICALCEILING TILE & GRIDEXISTING GYP BOARDCEILING; PATCH & REPAIRSTAINLESS STEELCLOSURE PANELEXISTING WOODTRUSSES; FIELDVERIFY DESIGN &LOCATIONSTAINLESS STEELWORK TABLESHELVINGSHEETERPROFFER CABINET10'-0"S/S TABLEWOOD TOPBAKERS TABLESHIP LAPSIDINGVERTICAL ACOUSTICALCEILING FROM 8'-0" TO 12'-0"FOR STORAGE ABOVE W.I.C.AT PERIMETER OF W.I.C.WALK-IN-COOLERFIRE-RETARDANTTREATED PLYWOODBLOCKINGFRPDUCTWORK SEAMLESSLYWELDED LIQUIDTIGHT, TYP.HOOD DUCTS - DUCT WRAP EQUALTO 3M FIRE BARRIER DUCT WRAP 615+INSULATION - ZERO CLEARANCE PRODUCT18 GA, #4 WELDED STAINLESS STEELEXHAUST HOOD BY CAPTIVEAIRESTAINLESS STEEL PANEL (80" HIGH) SUPPLIED &INSTALLED BY EQPT. CONTRACTOR TOCOVER PORTIONS OF WALL UNDER THEEXHAUST HOOD.5/8" FIRE-RATED GYP BOARD (TYP X) (EXTENDSTHE FULL LENGTH AND HEIGHT OF THE WALLBEHIND THE HOOD, THE TYPE "x" BOARDS AREFASTENED WITH 2" #12 SCREWS DRYWALLSCREWS. SCREW PATTERN: FASTENERS @ 4"AROUND THE PERIMETER AND 6" IN THE FIELD1/2 " CEMENTITIOUS WALLBOARD (EXTENDS 24"BEYOND THE HOOD ON EACH SIDE). THECEMENT BOARDS ARE FASTENED WITH 2"DUROCK COURSE THREAD #10 SCREWS.SCREW PATTERN: FASTENERS @ 4" AROUNDTHE PERIMETER AND 6" IN THE FIELD20 ga STAINLESS STEEL PLATE (80" HIGH-EXTENDS 18" BEYOND THE HOOD ON EACHSIDE). THE PLATE IS FASTENED TO THE WALLWITH LIQUID NAILSROOF FLASHING, TYP.SUPPLY DUCT:CARBON STEEL NOT LESS THAN 16GAOR STAINLESS STEEL NOT LESS THAN18GADUCT CLEANOUTS AT CHANGE INDIRECTIONS, TYP.STAINLESS STEEL CLOSURE PANELSTAINLESS STEELFILTERS2'-3"1'-9"4'-0"2'-5"08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.1SCALE:1/4":1'0"ELEVATION05SCALE:1/4":1'0"ELEVATION06SCALE:1/4":1'0"ELEVATION07SCALE:1/4":1'0"ELEVATION08SCALE:3/4":1'0"KITCHEN HOOD SECTION09SCALE:1/2":1'0"ADA COUNTER DETAIL SOLID SURFACECOUNTER TOP1'-0"2'-10"4"PROVIDE CONCEALEDMETAL SUPPORTBRACKETS @24" O.C.2X4DOUBLETOP PLATE1'-6"2" STAINLESS STEELWRAP AROUNDOPENING10'-0" 2'-10"SLOPEDSHELVING DONUTDISPLAY RACKCHALKBOARD; FIELD VERIFYDIMENSIONS AND MOUNTINGHEIGHT WITH GC; PROVIDEDBY GCU/C REFw/GLASS DOORS/S STAGINGTABLECOFFEESTATION08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 LNCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 INTERIOR ELEVATIONS A-5.2SCALE:1 1/2"=1'-0"CUSTOMER COUNTER DETAILSCALE:1/4":1'0"ELEVATION10 1220 Minimum Passage Width for One WheelchairInternational Symbol of Access for Hearing LossWheelchair TransferFig. A6Positions on toilet.Side Approach(b)3Transfers.armrest, sets brakes.Takes transfer position, removes21Diagonal Approach(a)brake.Positions on toilet, releases90 to the toilet).people fold chair or pivot itway, changes position (someMoves wheelchsir out of the43Removes armrest, transfersbrakes.footrest out of the way, setsTakes transfer position, swings2145510551842455455-7601818-301/2 max1/2 maxCane Technique6150150627655 Objects Mounted on Posts or PylonsProtruding Objects (Continued)Fig. 8 (d)Fig. 8Elevationcane range12 max305cane rangethis overhang can begreater than 12 (305)because no one canapproach the objectfrom this directionPlanProtruding ObjectsWalking Perpindicular to a Wall30512 maxFig. 8Fig. 8 (b)cane range1506long dimensionroute of travelperpindicular toGrating OrientationFig. 8 (h)Fig. A436-60 pace915-1525 6150Fig. 302.2Carpet Pile Thickness13GratingsFig. 8 (g)1360 min cane hits post or pytonbefore person hits objectLimits of Protruding ObjectsFig. 307.2preater than 27685 X>80 min.2030higher than 2768568527 max.27 or below685 Lobby4 max.10048122048 max 20 maxclear widthany amount481220XZ30760ElevationDETECTIONFig. 8 (c) freestanding Overhanging ObjectsFig. 307.4 Vertical Clearance AREACANEarea fromcross-trafficprotect shadedPlan2030predominant directionof trafficX<8068527 685 27 max.greater than 12305greater than 1230648 min.UNOBSTRUCTED FORWARD REACH15 min.48 max1220380FIGURE 308.2.148122048122030760 48 min.Lavatory ClearanceFig. 31depthclearancetoe43015017 min.6 max.2058 min.clearanceknee1015 865 735685230 40 max. 34 max.29 min.27 min.9 min.604.1.8.6Clear Floor Space Lavatories122048 min.clearfloorspace19 max.76030 min.48517 min.430door locationapproach only,42 min. latchother approaches81532 min.1004 max.81532 min.4 max.100 alternateClear Floor Space at Water ClosetsFig. 604.360 min.1525clearfloorspace142056 min. 54 min.Front Approach, Pull Side48 min.Front Approach - Sliding DoorsMinimum Clear Floor Space for WheelchairsSpace Requirements for WheelchairSeating Spaces in SeriesFig. 46(b)Side Access167566 min.1525 Additional Maneuvering Clearances for AlcovesFig. 4(e)maneuvering clearance of 12 in (305 mm) shall beNOTE:if x 15 in (380 mm), then an additionalprovided as shown.481220X 30512provided as shown.maneuvering clearance of 6 in (150 mm) shall beNOTE:x 24 in (610 mm), then an additionaland One Ambulatory PersonFig. a148 min. 1220 Forward or Rear Access(a)66 min.1675160760306X NOTE:x 15 in (380 mm.)30 760 601525X>15 Fig. 2Minimum Clear Widthfor Two Wheelchairs60 min.1525NOTE:x 24 in (610 mm).48 1220 76036X>24 34 max.Obstructed High Side Reach Drinking Fountains and Water CoolersFig. 27Fountain or Cooler1220 48 min.built-in(d)76030 min.fountain depthnot to exceed(a) Shelves10 max.535adjustable range 15 min. 380 48 max. 1220 Fig. 308Side ReachFig. 308.3.2865 48 max(c)Fountain or Coolerfreestanding1220 48 min.Clear Floor Space30 min.760610(b)24 max.760 30 min.76030255-610>10-24 MAX1170 46 max 60 min.Unobstructed Side Reach15 mine 380 Fig. 308.3.11220 1370Latch Side Approach - Sliding Doors and Folding DoorsManeuvering Clearances at Doorways Without Doors, and Folding DoorsSlide Side Approach - Sliding Doors1065 42 min.Fig. 404.2.4.2(f)(a)and Folding Doors1220 24 min.61042 min. 1065 (b)Maneuvering Clearances at Manual Swinging Doors and Gates1370 Fig. 404.2.4.1Front Approach, Push Side42 min.1065(d)22 min.56054 min.1065 42 min.18 min.1525 45548 min. 1220 Doors in Series and Gates in Series Fig. 404.2.6desk armWheelchair Turning SpaceFig. 3Fig. 304.3.212 min.91536 min.12 min.1525 60 min. 915 36 min.60-in (1525-mm)-Diameter Space(a)152560 min.1525 60 min.NOTE: Footrest may extend further for tall peopleDimensions of Adult-Sized Wheelchairsaccessible path of travelMinimum Clearances for Seating and TablesMinimum Clear Widthof an Accessible Route91536 min.Fig. 403.5.132 min.815for min. clearance 24 max. depth Forward760(b)3048 1220 Parallel(a)481220760 30 International SymbolsInternational TDD Symbol30760255Clear Floor Space10 max.1506 max.equipment permitted in shaded area122048 min.430-48517-19Knee ClearanceSpout Height and2058 min.307 & 6029 min.430-48517-1936 max. AFF 685 230 27 min. 915 Parallel Approach10 max.25576030(a)7603048 1220 48530760 Fig. 4591519 3648548591519193612204830 760 1220 48 3076048 1220 421065760 30 Fig. 305.348 MIN122036 915 30 76030 760 handlearmrestSignage HeightInternational Symbol of AccessibilityInternational Symbol of AccessibilityDisplay ConditionsFig. 703.7.2.160" MAX. (1525) (measured from the baseline of the highest tactile character)Braille Pictogram710710Maximum Doorway DepthClear Width of Doorways 48 min.1220815(c)Folding Door32 min.Fig. 404.2.3Detail815(b)32 min.Sliding Door24 max.48 min.1220(e)610 Hinged Door81532 min.(a)Fig. A3 (a)78 min.1965Space Needed for Smooth U-turn in a wheelchair32 min.815685 19 485 27 43-51 1090-1295 8 205 18 455 seattoelapLC81532 min.Fig. A260 min. 1525 LC30eye level9 LC30LCLC24712 ra d i u s 1 7 48LC LC246 ra d i u s7173 1 48LC54 max. 1370Fig. 54Tableware Areas36 min.91534 max. 865Fig. 53Food Service Lines1220 48 max.21 max.Fig. 38(b) Closets535Storage Shelves and ClosetsT-Shaped Turning SpacePosition of Clear Floor or Ground SpaceFig. 305.5Forward ApproachFig. 305.7.1Parallel ApproachFig. 305.7.2Maneuvering Clearance in an Alcove 48 1220 (a)Front Approach, Push Side(b)Hinge Approach, Pull Side(e)Hinge Approach, Push Side(f)Sliding Doors, Gates, and Folding Doors22 min.5603805 max12515 minFig. 602.5Drinking Spout Location15 min. 380Fig. 604.7DISPENSER OUTLET LOCATIONWATER CLOSET LOCATIONFig. 604.2405-45516-18CL(a) wheelchairaccessible water closetWATER CLOSET LOCATIONFig. 604.2430-48517-19CL(b) ambulatoryaccessible water closet7-948 max. 1220180-230CL56 min.1420 60 min.1525Wheelchair Accessible Toilet Compartment DoorsFig. 604.8.1.2Size of Clearance at Water ClosetsFig. 604.3.1Wheelchair Accessible Toilet Compartment Toe ClearanceFig. 604.8.1.49 min.230 6 min.150partition12 min.305 6 min.150partition(b)elevationchildren(a)elevationadult(c)plan6 min.150 6 min.15060 min.1525Size of Wheelchair Accessible Toilet CompartmentFig. 604.8.1.1(a)adult wall hungwater closet56 min.1420 60 min.1525(b)adult floor mounted water closetand childern's water closet59 min.1420 60 min.1525Wheelchair Accessible Toilet CompartmentFig. 604.8.1.6in New Construction48" (1220) MAX. (measured from the baseline of the lowest tactile character)Height of Tactile characters above Finish Floor or GroundFig. 703.4.1Fig. 703.7.2.2Fig. 703.7.2.4Volume Telephone ControlFig. 703.7.2.348 min. 122012 minFront Approach, Push Side(c)306door provided with bothcloser and latch36 min60 min915 1525 48 min. 1220 22 min.1065Hinge Approach, Pull Side(g)Latch Approach, Pull Side(h)24 min.106548 min. 1220door provided with bothcloser and latch54 min. 1370 24 min.610Latch Approach, Pull Side(i)door provided with closer24 min.6101065 42 min.Latch Approach, Push Side(j)24 min.6101220 48 min.Latch Approach, Push Side(k)door provided with closerTO REFLECTING SURFACE 1220 510UNOBSTRUCTED FORWARD REACHFIGURE 308.2.148122044 max >20-25 max1120 510-635(a)(b)74 min.FOR REFERENCEONLY; REFER TOFLORIDAACCESSIBILITYCODE 7th EDITION(2020) FOR BUILDINGCONSTRUCTIONURINALSCREENWALL HUNGWALL HUNG13 1/2" min.34513 1/2" min.34517" max.43013 1/2" min.345(a)wall hung type(b)stall typeHeight and Depth of UrinalsFig. 605.23691636 916 36 916481220 back wallCLCLcontrolwallseatwallCLNote: inside finished dimensions measured at the center pointsof opposing sidesTRANSFER TYPE SHOWER COMPARTMENT SIZE AND CLEARANCEFig. 608.118455controlwallseatwallbackwallGRAB BARS FOR TRANSFER TYPE SHOWERSFig. 608.3.1side (control)CLwall48 1220 38 965 15 max455TRANSFER TYPE SHOWER COMPARTMENT CONTROL LOCATIONFig. 608.5.122-23560-585seatwallL-SHAPED SHOWER SEATFig. 610.3.214-15 355-38015-16380-405seatwall1 1/2" max 382 1/2" max64(a)size(b)distance from wallseatwallcompartmententry3" max 75(b)L-shapedEXTENT OF SEATFig. 610.342 min.12 MAX12 min.24 min.305610Rear WallFig. 604.5.233-36 305840-915840-915Side Wall106517-19430-48633-36 36 min.91554 min.1370CLREAR WALL GRAB BAR WATER CLOSETSCONTROLS604.6 - CONTROLS SHALL BE MOUNTED ON THE OPEN SIDE OF THE WATER CLOSET EXCEPT IN AMBULATORY ACCESSIBLECOMPARTMENTS COMPLYING WITH 604.8.2Fig. 604.5.1SIDE WALL GRAB BAR WATER CLOSETSTRANSFER SIDEFINISH FLOORGRIPPING SURFACEFINISH FLOORGRIPPING SURFACE08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE csommers@dsae.net CRAIG A. SOMMERS, AIA 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.ARCHITECT - AR0016480 CASCASISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 ACCESSIBILITY GUIDELINES A-6 COMM22-0035 E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.FFFF FFFFFFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF EXH FANEXH FANELECTRICALPANELELECTRICALPANELFFFFFFFF FFFF EXISTINGEXISTINGFFFF FFFFFFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF 08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CMDCMDISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CAREN M. DOHERTY, P.E. FL P.E. #-55021 LIGHTING PLAN E-1NOTE: SITE VISIT REQUIRED BY ELECTRICAL BIDDERSBIDDERS ARE REQUIRED TO VISIT THE SITE AND BECOME FAMILIAR WITH EXISTING CONDITIONS ANDSATISFY THEMSELVES AS TO THE NATURE AND SCOPE OF WORK PRIOR TO SUBMISSION OF BID. THESUBMISSION OF A BID WILL BE EVIDENCE THAT SUCH AN EXAMINATION HAS BEEN MADE. LATERCLAIMS FOR LABOR, EQUIPMENT, OR MATERIALS REQUIRED, OR FOR DIFFICULTIES ENCOUNTEREDWHICH COULD HAVE BEEN FORESEEN HAD AN EXAMINATION BEEN MADE, WILL NOT BE ACCEPTED.COORDINATE WITH OTHER TRADES FOR ITEMS IN THEIR SCOPE OF WORK WHICH WOULD REQUIREDADDITIONAL WORK AND ARE NOT INDICATED ON THESE PLANS.ANY DISCREPENCY BETWEEN THESE DRAWINGS AND EXISTING CONDITIONS SHALL BE BROUGHT TOLIGHTING CONTROL DETAILTHE ENGINEERS ATTENTION.SCALE:1/4"=1'-0"LIGHTING PLAN E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CMDCMDISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CAREN M. DOHERTY, P.E. FL P.E. #-55021 POWER PLANSCALE:1/4":1'0"POWER PLANE-2NOTE: SITE VISIT REQUIRED BY ELECTRICAL BIDDERSBIDDERS ARE REQUIRED TO VISIT THE SITE AND BECOME FAMILIAR WITH EXISTING CONDITIONS ANDSATISFY THEMSELVES AS TO THE NATURE AND SCOPE OF WORK PRIOR TO SUBMISSION OF BID. THESUBMISSION OF A BID WILL BE EVIDENCE THAT SUCH AN EXAMINATION HAS BEEN MADE. LATERCLAIMS FOR LABOR, EQUIPMENT, OR MATERIALS REQUIRED, OR FOR DIFFICULTIES ENCOUNTEREDWHICH COULD HAVE BEEN FORESEEN HAD AN EXAMINATION BEEN MADE, WILL NOT BE ACCEPTED.COORDINATE WITH OTHER TRADES FOR ITEMS IN THEIR SCOPE OF WORK WHICH WOULD REQUIREDADDITIONAL WORK AND ARE NOT INDICATED ON THESE PLANS.ANY DISCREPENCY BETWEEN THESE DRAWINGS AND EXISTING CONDITIONS SHALL BE BROUGHT TOFAULT CURRENT AT 22KAIC: EXCEEDS BES TRANSTOTAL AMPS @ 208 3PHTOTAL LOADWALK IN COOLERHWHLIGHTING (SQ. FEET)25% OF LARGEST MOTORRECEPTACLESSIGNAHUHOOD SYSTEMCUCOFFEE/TEA MAKER KITCHEN EQUIPMENTTHE ENGINEERS ATTENTION. E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.FFFF FFFFFFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF EXH FANEXH FANELECTRICALPANELELECTRICALPANELFFFFFFFF FFFF EXISTINGEXISTINGFFFF FFFFFFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF FFFF 08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CMDCMDISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CAREN M. DOHERTY, P.E. FL P.E. #-55021 LIGHTING PLAN E-1NOTE: SITE VISIT REQUIRED BY ELECTRICAL BIDDERSBIDDERS ARE REQUIRED TO VISIT THE SITE AND BECOME FAMILIAR WITH EXISTING CONDITIONS ANDSATISFY THEMSELVES AS TO THE NATURE AND SCOPE OF WORK PRIOR TO SUBMISSION OF BID. THESUBMISSION OF A BID WILL BE EVIDENCE THAT SUCH AN EXAMINATION HAS BEEN MADE. LATERCLAIMS FOR LABOR, EQUIPMENT, OR MATERIALS REQUIRED, OR FOR DIFFICULTIES ENCOUNTEREDWHICH COULD HAVE BEEN FORESEEN HAD AN EXAMINATION BEEN MADE, WILL NOT BE ACCEPTED.COORDINATE WITH OTHER TRADES FOR ITEMS IN THEIR SCOPE OF WORK WHICH WOULD REQUIREDADDITIONAL WORK AND ARE NOT INDICATED ON THESE PLANS.ANY DISCREPENCY BETWEEN THESE DRAWINGS AND EXISTING CONDITIONS SHALL BE BROUGHT TOLIGHTING CONTROL DETAILTHE ENGINEERS ATTENTION.SCALE:1/4"=1'-0"LIGHTING PLAN E1 UTILITYCABINET.WALK-IN-COOLER106JAN CLOSET109MEN'SROOM108WOMEN'SROOM107KITCHEN/PREP/DW105ORDERCOUNTER102SEATINGAREA101OFFICE103CONDIMENTAREA104CLOSER PANEL &SEALANTBETWEEN WALL &W.I.C, TYP.08-23-22SHEET TITLE:SHEETDATE:NO.DRAWN BY:CHECKED BY:REVISIONDATE 370 15th Ave S; Units A & B Jacksonville Beach, FL 32250 904.249.0698 p DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC. 904.241.0691 f www.dsae.net Florida Certificate of Auth No: 00009393 Florida License No.: AA26000952DESIGNER EXPRESSLY RESERVES HIS COPYRIGHT AND OTHER PROPERTY RIGHTS IN THESE DRAWINGS.THESE DRAWINGS, PLANS & DESIGNS ARE NOT TO BE REPRODUCED, COPIED OR USED IN ANY MANNER WITHOUTEXPRESSED WRITTEN PERMISSION AND CONSENT OF DOHERTY SOMMERS ARCHITECTS ENGINEERS, INC.THESE PLANS SHALL NOT BE DISTRIBUTED TO ANY PARTY WITHOUT SAID WRITTEN PERMISSION & CONSENT.CMDCMDISLAND DONUTS TENANT BUILD-OUT ATLANTIC BEACH, FL 32233 363 ATLANTIC BLVD - UNITS 6 & 7 CAREN M. DOHERTY, P.E. FL P.E. #-55021 POWER PLANSCALE:1/4":1'0"POWER PLANE-2NOTE: SITE VISIT REQUIRED BY ELECTRICAL BIDDERSBIDDERS ARE REQUIRED TO VISIT THE SITE AND BECOME FAMILIAR WITH EXISTING CONDITIONS ANDSATISFY THEMSELVES AS TO THE NATURE AND SCOPE OF WORK PRIOR TO SUBMISSION OF BID. THESUBMISSION OF A BID WILL BE EVIDENCE THAT SUCH AN EXAMINATION HAS BEEN MADE. LATERCLAIMS FOR LABOR, EQUIPMENT, OR MATERIALS REQUIRED, OR FOR DIFFICULTIES ENCOUNTEREDWHICH COULD HAVE BEEN FORESEEN HAD AN EXAMINATION BEEN MADE, WILL NOT BE ACCEPTED.COORDINATE WITH OTHER TRADES FOR ITEMS IN THEIR SCOPE OF WORK WHICH WOULD REQUIREDADDITIONAL WORK AND ARE NOT INDICATED ON THESE PLANS.ANY DISCREPENCY BETWEEN THESE DRAWINGS AND EXISTING CONDITIONS SHALL BE BROUGHT TOFAULT CURRENT AT 22KAIC: EXCEEDS BES TRANSTOTAL AMPS @ 208 3PHTOTAL LOADWALK IN COOLERHWHLIGHTING (SQ. FEET)25% OF LARGEST MOTORRECEPTACLESSIGNAHUHOOD SYSTEMCUCOFFEE/TEA MAKER KITCHEN EQUIPMENTTHE ENGINEERS ATTENTION. ii 8. Premises: Suite 6 & 7 of the building commonly known as The Shoppes of Northshore, located on certain real property with an address of 363 Atlantic Blvd, Atlantic Beach Duval County, Florida 9. Floor Area of Premises: 2,017 square feet 10. Rentable Area of Building: 17,190 square feet 11. Tenant’s Share: 2,017 / 17,190 = 11.734% 12. Permitted Use of Premises: Section 5.1 Permitted Use – For the (i) operation of an Island Donuts location for on or off premises consumption of the following: Donuts and related products and merchandise sold at Island Donuts and (ii) ancillary uses incidental thereto. 13. Term of Lease: Five (5) years and One Hundred and Eighty (180) Days “Commencement Date”: Upon Lease Execution “Rent Commencement Date”: December 1st, 2022 “Expiration Date”: November 30th, 2027 14. Prepaid Rent: $____________ (includes sales tax) (due upon execution of Lease; to be applied to first (1st) month that Minimum Rent is due) 15. Percentage Rent: Commencing on the Rent Commencement Date and thereafter throughout the Term of the Lease, Tenant shall pay to Landlord percentage rent equal to _Zero_ PERCENT (0%) of Tenant’s Gross Sales (as defined in Section 3.2(b) of the Lease) during each Lease Year in excess of $NA 16. Security Deposit: $____________ (due upon execution of Lease) 17. Cost Pass-Throughs: Operating Expenses (as defined in Article 6 of the Lease and including Real Estate Taxes and Insurance), on a “triple net” basis 18. Additional Rent: As provided for in Section 3.2 and referenced in Article 6 of the lease. Current estimated Additional rent is $6.50 per square foot annually, or $1,092.54 monthly 19. Broker(s): Colliers International (“Landlord’s Broker”) (representing Landlord); Prime Realty (“Tenant’s Broker”) (representing Tenant) (Section 21.5) 20. Option Period(s): One (1) Option for a term of Five (5) Years iii 21. Minimum Rent: Lease Year Per Square Foot Monthly Minimum Rent Annual Increase (included in rent amounts) 5/1/22 – 10/31/22 ABATED ABATED NA 11/1/22 – 10/31/23 $35.00 $5,882.92 NA 11/1/23 – 10/31/24 $36.05 $6,059.40 3% 11/1/24 – 10/31/25 $37.13 $6,241.19 3% 11/1/25 – 10/31/26 $38.25 $6,428.42 3% 11/1/26 – 10/31/27 $39.39 $6,621.27 3% Option 1 Lease Year Per Square Foot Monthly Minimum Rent Annual Increase (included in rent amounts) 11/1/27 – 10/31/28 $40.57 $6,819.91 3% 11/1/28 – 10/31/29 $41.79 $7,024.51 3% 11/1/29 – 10/31/30 $43.05 $7,235.25 3% 11/1/30 – 10/31/31 $44.34 $7,452.30 3% 11/1/31 – 10/31/32 $45.67 $7,675.87 3% {Remainder of page intentionally left blank} 1 ARTICLE I INTRODUCTORY PROVISIONS Section 1.1. References and Conflicts. References to Sections appearing in the Summary of Certain Provisions are to designate some of the other locations in this Lease where additional provisions applicable to the particular items within the Summary of Certain Provisions appear. Each reference in this Lease to any item within the Summary of Certain Provisions shall be construed to incorporate all of the terms provided for under such provision and shall be read in conjunction with all other provisions of this Lease applicable thereto. If there is any conflict between the terms contained in the Summary of Certain Provisions and any other provisions of this Lease, the latter shall control. Section 1.2. Exhibits. The following drawings and special provisions are attached to this Lease as exhibits and are hereby made a part of this Lease: Exhibit A - Survey Exhibit B - Rules and Regulations Exhibit C - Commencement and Expiration Date Declaration Exhibit D - Sign Criteria Exhibit E - Exclusive Uses Exhibit F [Intentionally Deleted] Section 1.3. General Definitions. In addition to the terms defined in the Summary of Certain Provisions, the following terms, whenever used in this Lease with the first letter of each word capitalized, shall have only the meanings set forth in this Section 1.3, unless such meanings are expressly modified, limited or expanded elsewhere in this Lease: (a) “Additional Rent” means all amounts other than Minimum Rent due and owing to Landlord under this Lease including, without limitation, Tenant’s Share of Operating Expenses, including common area maintenance, Real Estate Taxes and Insurance. (b) “Operating Expenses” means an amount, included in Additional Rent, for Tenant’s share of operating expenses, including common area maintenance, real estate taxes and insurance, for the operation of the Premises as more particularly described in Article 6. (c) “Common Areas” mean all areas, facilities and improvements (as the same may be enlarged, reduced, replaced, removed or otherwise altered by Landlord) from time to time made available in the Project by Landlord under Section 2.1 of this Lease for the non-exclusive common use of occupants of the Project, including Tenant, its agents, employees and invitees. The Common Areas shall include, without limitation, lobbies (at ground level or otherwise), mail rooms, parking areas, decks and facilities, sidewalks, stairways, escalators, conduits, elevators, service corridors, fire corridors, seating areas, truck ways, ramps, loading docks, delivery areas, landscaped areas, park areas, hardscape elements (including fountains), retention/detention areas, park areas, package pickup stations, public restrooms and comfort stations, access and interior roads, retaining walls, drainage systems, bus stops and lighting facilities. Notwithstanding anything in the foregoing to the contrary, the Common Areas shall not include any stairways, ramps, loading docks or delivery areas included in the Premises, if any, or in the premises of any occupant of the Project and intended for such occupant’s exclusive use. Except as herein specifically provided, Tenant shall have no right or interest in the Common Areas. If the Common Areas shall be so changed or diminished, then Landlord shall not be subject to any liability nor shall Tenant be entitled to any compensation or abatement of rent nor shall revocation or diminution of the Common Areas be deemed constructive or actual eviction of Tenant, so long as such changes (i) to not materially and adversely limit or reduce Tenant’s right to utilize such Common Areas or the parking provided pursuant to this Lease, (ii) do not reduce parking below what is existing (iii) do not materially and adversely limit or reduce access to and from public roads adjoining the Project as of the Effective Date, (iv) do not materially and adversely 2 reduce visibility from public rights of way and (v) so long as such changes are of similar quality as the Project is initially constructed. Subject to Landlord’s right to change or alter any of the Common Areas, Tenant shall have, as appurtenant to the Premises, the non-exclusive right to use the Common Areas in common with others, subject to reasonable rules of general applicability to tenants and other occupants and users of the Project from time to time made by Landlord of which Tenant is given notice. (d) [Intentionally Deleted] (e) “Lease Year” means the twelve (12) month period beginning on the first day of the month immediately following the Commencement Date and terminating on the same day of the succeeding year, and on the same day of each year thereafter during the Term. The period of time, if any, between the Commencement Date and the first day of the month immediately following the Commencement Date shall be considered to be a part of the first Lease Year. (f) [Intentionally Deleted] (g) “Tenant’s Share” means a fraction, the numerator of which is the Rentable Area of the Premises (2,017 square feet) and (i) the denominator of which is the sum of the Rentable Area of the Building (17,190 square feet). Landlord reserves the right to increase or decrease the Rentable Area of the premises at its sole and absolute discretion from time to time. (h) “Interest” means the Prime Rate reported in the Money Rates section of The Wall Street Journal on the twenty-fifth (25th) day of the month preceding the date upon which the applicable obligation is incurred plus three percent (3%). (i) “Building” or “Building” means the building identified as on the Survey attached hereto as Exhibit A. (j) “Premises” means Suites 6 and 7 (consisting of approximately 2,017 square feet) of the building commonly known as The Shoppes of Northshore, located on certain real property with an address of 363 Atlantic Blvd, Atlantic Beach, Duval County, Florida. (k) “Project” means the center located at 363 Atlantic Blvd, Atlantic Beach, Duval County, Florida, and known as “Shoppes of Northshore” or such other name as Landlord may designate from time to time. The Project is further shown and delineated on the “Survey” attached hereto as Exhibit A. (l) “Rent” means Minimum Rent and Additional Rent. (m) “Rentable Area” means rentable square footage, whether or not actually leased or occupied, measured per the 2010 BOMA standards. The amount of Minimum Rent set forth in Paragraph 21 of the Summary of Certain Provisions is based upon the Rentable Area of the Premises. Upon substantial completion of construction of Landlord’s Work (as defined in Section 4.1 below), the Rentable Area of the Premises shall be determined by Landlord’s architect, and if the Rentable Area of the Premises differs by more than two percent (2%) from the Rentable Area of the Premises set forth in Paragraph 9, then the Minimum Rent shall be adjusted prior to the Commencement Date. Promptly after the Commencement Date, Landlord and Tenant shall execute and deliver a written declaration in the form attached hereto as Exhibit C. Landlord shall have the right to adjust the Rentable Area of the Building and other Buildings in the Project as they are completed. (n) “Rentable Area of the Premises” means the amount of space upon which Rent is payable 3 under this Lease as set forth in Paragraph 9 of the Summary of Certain Provisions. (o) “State” means the State of Florida. (p) “Taxes” shall mean and include all federal, state, county, or local governmental or municipal taxes, fees, charges or other impositions of every kind and nature, whether general, special, ordinary or extraordinary (including, without limitation, real estate taxes, general and special assessments and interest thereon whenever the same may be payable in installments), transit taxes, leasehold taxes or taxes based upon the receipt of rent, including sales taxes applicable to the receipt of rent, unless required to be paid by Tenant, which may be levied or assessed by, or are payable to, any lawful authority during or with respect to any calendar or fiscal year falling in whole or in part during the Term because of or in connection with the ownership, leasing and operation of the Project. Taxes shall also include, without limitation, any assessment, tax, fee, levy or charge in addition to, or in substitution, partially or totally, for or as a supplement to any assessment, tax, fee, levy or charge previously included within the definition of Taxes. All such new and increased assessments, taxes, fees, levies and charges and all similar assessments, taxes, fees, levies and charges and service payments in lieu of Taxes shall be included within definition of Taxes. Tax refunds shall be deducted from Taxes in the year they are received by Landlord, but if such refund shall relate to Taxes paid in a prior year of the Term, and the Lease shall have expired, Landlord shall mail Tenant’s Share of such net refund (after deducting expenses and attorneys’ fees), up to the amount Tenant paid towards Taxes during such year, to Tenant’s last known address. Taxes shall not include: (a) any net income, excise, profits (other than a tax on gross profits), estate, gift, franchise, or capital stock tax or assessment upon Landlord; and (b) any fine, penalty, cost or interest for any tax or assessment, or part thereof, which Landlord failed to timely pay (except if same are imposed by reason of Tenant’s default hereunder). (q) “Underlying Documents”. The terms, conditions and provisions of this Lease and the rights of the parties hereto are subject to all matters of public record, public or private restrictions affecting Landlord, the Building, or the Project, and all applicable governmental rules and regulations, and are subject to and subordinate to any applicable Master Declaration of Easements, Covenants and Restrictions recorded in the relevant Public Records, as amended from time to time (the “Declaration”). Tenant agrees to comply with the provisions of the Declaration and any other recorded or unrecorded documents affecting the Building or the Project (the “Underlying Documents”). Landlord represents and warrants that the Permitted Use does not violate any restrictions, terms or conditions of the Declaration. ARTICLE II GRANT AND TERM Section 2.1. Premises. Landlord, in consideration of the Rent to be paid and the covenants to be performed by Tenant, does hereby lease and demise to Tenant, and Tenant hereby rents and hires from Landlord, for the Term, the Premises. Landlord shall have and hereby reserves the right at its reasonable discretion, at any time and from time to time during the Term, subject to the Declaration and so long as such changes (i) do not materially and adversely limit or reduce Tenant’s right to utilize such Common Areas or the parking provided pursuant to this Lease (ii) do not reduce parking below what is existing as of the Effective Date (iii) materially and adversely limit or reduce access to and from public roads adjoining the Project as of the Effective Date (iv) do not materially and adversely reduce visibility from public rights of way and (v) so long as such changes are of similar quality as the Project is initially constructed, to (i) redesignate, modify, alter, expand, reduce and to change the Common Areas including, without limitation, the area, level, location and arrangement of all parking areas, decks, roadways and driveways; and (ii) make alterations or additions to, and build additional stories on, the Building and to construct other buildings and improvements of any type in the Project for lease to tenants or for such other uses as Landlord desires, including the right to locate and/or erect thereon permanent or temporary kiosks and structures; and (iii) exclude from the Common Areas such building areas and related areas as Landlord shall designate. If Landlord elects to enlarge the Project, any additional 4 area may be included by Landlord in the definition of the Project. Landlord shall also have the general right from time to time to include within and/or to exclude from the defined Project any existing or future areas, subject to the foregoing limitations. This Lease is subject to all applicable building restrictions, planning and zoning ordinances, governmental rules and regulations, existing underlying leases, and all other encumbrances, covenants, restrictions and easements affecting the Project. No changes made by Landlord pursuant to this paragraph or otherwise in this Lease shall result in a increase in Tenant’s Share, notwithstanding in the case where Landlord sells some but not all of the Project, resulting in a higher pro rata share. Section 2.2. Term. (a) Term. The term of this Lease (the “Term”) shall commence on the Commencement Date and, unless sooner terminated as hereinafter provided, shall end on the Expiration Date, as such dates are respectively specified in the Summary of Certain Provisions. Landlord shall deliver the Premises to Tenant in accordance with Section 4.2 herein. (b) Option Periods. Tenant shall have the option (the “Option”) to extend the Term for the Option Period(s) identified in the Summary of Certain Provisions. Said options shall be exercised, if at all, by written notice via certified mail to Landlord at least one hundred eighty (180) days prior to the expiration of the then- current Term. Landlord shall have no obligation to notify the Tenant of such option notice period. All terms and conditions contained herein shall apply during the Option Periods except that Minimum Rent shall be in the amounts set forth in the Summary of Certain Provisions. If Tenant does not exercise the foregoing options to renew this Lease within the required time periods, then such options shall become null and void and be of no further force or effect. These options are only valid provided that Tenant is not then in default hereof beyond any applicable notice and cure periods, and have met the following terms and conditions: i. Tenant shall not have been late beyond any applicable cure period, on more than two (2) occasions within any twelve (12) month period during the Term of this Lease in the required payment of any Minimum Rent or Additional Rent. Landlord shall provide Tenant with a written notice of each late payment occurrence. ii. Tenant shall not have been in default of this Lease beyond any applicable cure period, for any reason, more than twice during the term of this Lease. Tenant shall be notified, as required under this Lease, of any instance of Default hereunder. iii. Tenant shall not have been in default of this Lease beyond any applicable cure period, for any reason, for a continuous period of thirty (30) days or more during the term of this Lease. ARTICLE III RENT Section 3.1. Minimum Rent. During the entire Term, Tenant shall pay annual minimum rental (“Minimum Rent”) for the Premises in the amount set forth in the Summary of Certain Provisions, which sum shall be payable by Tenant in equal consecutive monthly installments in the amount set forth in the Summary of Certain Provisions, without demand, deduction, set-off or counterclaim, except as may be specifically set out herein. The first installment of Minimum Rent shall be paid in advance on the Rent Commencement Date. If the Rent Commencement Date occurs on a day other than the first day of a month, the first installment of Minimum Rent shall be prorated at a daily rate based on the number of days in such month. Section 3.2. Additional Rent. 5 a) Any other sums owed by Tenant pursuant to the terms of this Lease b) In addition to any Minimum Rent payable under Section 3.1 above, Tenant shall pay to Landlord as Additional Rent, at the same time as payment of Minimum Rent are due and commencing on the Commencement Date, Tenant’s Share of the Operating Expenses (as defined in Section 6 below). The Operating Expenses paid or incurred by Landlord during the operating expense base year are currently estimated to be Six and 50/100 Dollars ($6.50) per square foot of the Rentable Area of the Premises. Tenant shall pay one-twelfth (1/12) of Tenant’s Share of Landlord’s estimate of the Operating Expenses, as provided in Article 6, as Additional Rent each month. No later than four (4) months following the end of each calendar year, Landlord will deliver a reconciliation statement (the “Reconciliation”) to Tenant showing the estimated payments made, and the actual amount of Operating Expenses for the applicable calendar year. In the event the total of these monthly payments for any one (1) calendar year is less than Tenant’s actual pro rata share of the Shopping Center’s Operating Expenses, then Tenant shall pay the additional sum to Landlord within fifteen (15) days after receipt of said Reconciliation. If such Reconciliation indicates an overpayment on Tenant’s part, Landlord shall reimburse Tenant for such overpayment upon delivery of the Reconciliation, failing which, Tenant may deduct any such amounts from any Rent due thereafter until fully paid. Section 3.3. Payment of Rent. Rent shall be paid to Landlord, in advance, on or before the first day of the Term hereof and on or before the first day of each and every successive calendar month thereafter during the Term of this Lease, at the Landlord’s Address set forth in the Summary of Certain Provisions (or at such other address of which Landlord shall have given Tenant notice in accordance with this Lease). All other Rent shall be paid as provided elsewhere in this Lease. In the event the term of this Lease commences on a day other than the first day of a calendar month or ends on a day other than the last day of a calendar month, then the monthly rental for the first and last fractional months of the term hereof shall be appropriately prorated. Section 3.4. Late Charge. If any Rent or other sums are not received within seven (7) days of when due, Tenant shall immediately pay, as Additional Rent, (i) a service charge equal to ten percent (10%) of the amount of such overdue payment for the purpose of defraying Landlord’s administrative expenses relative to handling such overdue payment plus (ii) Interest, which Interest shall accrue beginning on the date the payment was originally due and payable. Sales tax is to also be paid on these amounts by the tenant. As Rent or other sums under this lease are due the 1st day of each Month, the Late Charge will apply in the event rent is not received by the end of business on the 7th day of each month. Section 3.5. Sales and Use Tax. Tenant shall pay all Florida sales and use tax due on Minimum Rent, Additional Rent and all other amounts payable by Tenant to Landlord under this Lease upon which Florida sales and use tax may be imposed from time to time pursuant to Section 212.031, Florida Statutes, or any similar or successor law. Section 3.6. Rent Abatement. Notwithstanding anything in this Lease to the contrary, and as further consideration for Tenant’s obligations set forth herein, Tenant’s first one hundred and eighty days of rent shall be fully abated beginning on the Commencement Date (the “Rent Abatement Period”). During the Rent Abatement Period Tenant is still required to pay its proportionate share on a monthly basis of real estate taxes, property insurance and the cost to operate and maintain the common areas of the Shopping Center. Thereafter, Tenant shall be required to pay the full amount of Minimum Rent pursuant to this terms and conditions of this Lease. Section 3.7. Security Deposit. Concurrently with the execution of this Lease, Tenant shall deposit with Landlord the sum set forth in Paragraph 16 of the Summary of Certain Provisions as security for the punctual performance by Tenant of each and every obligation of Tenant under this Lease (such sum is hereinafter referred to as the “Security Deposit”). In the event of any default by Tenant, in addition to and without prejudice to any other rights and remedies available the Landlord, Landlord may, without notice, apply or retain all or any 6 part of such Security Deposit to cure the default or reimburse Landlord for any sum which Landlord may spend by reason of the default. In the case of every such application or retention, Tenant shall, on demand, pay to Landlord the sum applied or retained which shall be added to the Security Deposit so that the same shall be restored to its original amount. If, at the end of the Lease Term, Tenant is not in default under this Lease, but not otherwise, the Security Deposit, or any balance thereof, shall be returned to Tenant. No interest shall be paid on the Security Deposit and Landlord shall not be required to maintain the Security Deposit in a segregated account. It is expressly understood and agreed that the Security Deposit is not an advance payment of or on account of the Rent herein reserved or any part or installment thereof or a measure of Landlord’s damages. ARTICLE IV PREPARATION OF PREMISES Section 4.1. Landlord’s Work. Landlord is not responsible for any work other than to deliver the space to tenant as-is. Section 4.2. Delivery of Possession. Landlord shall deliver the space to Tenant upon execution of lease and commencement of the term. From and after the Delivery of the Premises, Tenant may access the Premises twenty-four (24) hours per day, seven (7) days per week, including holidays and inclement weather conditions as permitted by governing authorities. Section 4.3. No Representations. Tenant acknowledges that, except as otherwise set forth herein: (a) neither Landlord nor Landlord’s agents or employees have made any representations or warranties as to the suitability or fitness of the Premises for the conduct of Tenant’s business or for any other purpose; (b) neither Landlord nor its agents or employees have agreed to undertake any alterations or construct any improvements to the Premises; (c) Tenant has been advised to satisfy itself regarding the condition of the Premises including without limitation the heating, ventilation and air conditioning (“HVAC”) systems, electrical and fire sprinkler systems and any structural or environmental matters and the present and future suitability of the Premises for Tenant’s intended use; (d) Tenant has been advised to satisfy itself regarding the Premises’ compliance with the Americans with Disabilities Act and all other applicable requirements, including all municipal, county, state and federal laws, ordinances, rules and regulations, orders, permits and zoning, the requirements of any applicable fire insurance underwriter or rating bureau and any covenants, restrictions or other matters of record relating to Tenant, the Premises or the use thereof (collectively, “Laws”). Tenant further acknowledges, by taking possession of the Premises, that as of the Commencement Date: (e) Tenant has been given access to the Premises and has made such investigation as it deems necessary with reference to the matters set forth in this Section, is satisfied with reference thereto, and assumes all responsibility therefor as the same relate to Tenant’s occupancy of the Premises and/or the terms of this Lease; and (f) neither Landlord nor any of its agents or employees has made any oral or written representations or warranties regarding said matters or the condition of the Premises other than as expressly set forth in this Lease. Section 4.4. Tenant’s Work. (a) The Tenant shall be given a Tenant Improvement Allowance by Landlord of Fifty Thousand Four Hundred and Twenty Five and 00/100 Dollars ($50,425.00) or $25.00 per square foot of Tenant’s Rentable Area (the “Tenant Improvement Allowance”) to cover the costs up to this amount for all Tenant’s Plans indicated on the Tenant’s improvement plans submitted to and approved by Landlord, which shall constitute the Tenant’s Work (the “Tenant’s Work”) to the Premises. All of the Tenant Improvement Allowance shall be available to the Tenant and can be applied towards construction of interior improvements of Tenant areas further defined in Tenant’s Plans. Tenant shall have the right to use consultants and contractors of Tenant’s choice, 7 subject to Landlord’s reasonable approval rights. Upon completion of the Tenant’s Work, Tenant shall produce to Landlord a total invoice for applicable expenses and be credited the cost of the work applicable under this section up to the Tenant Improvement Allowance. So long as Tenant is not in default beyond applicable cure period, the allowance will be paid within thirty (30) days after Tenant opens for business, pays first month’s Rent, and furnishes Landlord paid invoices, final lien waivers, and any other documentation Landlord reasonably requires. Any expense incurred above the Tenant Improvement Allowance is the sole responsibility of the Tenant. If Tenant does not provide the Tenant Allowance Request to Landlord within two hundred seventy (270) days of the Commencement Date of this Lease, then Tenant shall be deemed to have waived, without the requirement of any notice, any right to the Tenant Allowance and Landlord's reimbursement obligation under this Article shall be deemed null and void and of no further force or effect. (b) Except as specifically set forth immediately above, or as required by another section of the Lease, Tenant shall not make any alterations, repairs, additions or improvements to the Premises without the prior written consent of Landlord, such consent not to be unreasonably withheld, conditioned or delayed. If Landlord grants such consent, such alterations, additions or improvements shall be performed in good and workmanlike manner and in accordance with all applicable legal and insurance requirements and all drawings and specifications approved by Landlord, and in accordance with the provisions of this Lease. Tenant shall not commence any alterations or improvements to the Premises unless and until Landlord approves the plans and specifications for such work. Notwithstanding the foregoing, Landlord’s written approval (and submission of plans and specifications) shall not be required for any alterations or improvements that satisfies the following criteria: (i) is of a purely cosmetic nature such as painting, wallpapering, hanging pictures and installing flooring; (ii) is not visible from the exterior of the Premises or Building; (iii) will not affect the systems or structure of the Building; (iv) does not require work to be performed inside the walls or above the ceiling or below the floor of the Premises; and (v) costs less than twenty thousand dollars ($20,000.00). This provision supersedes any provision in Landlord’s Rules and Regulations prohibiting the use of nails, screws, paint or other material in the decoration of the Premises by Tenant. As a part of Tenant’s Work, in the event the space is not sub-metered for all utilities, Tenant will be responsible for submetering the space, or reimburse Landlord for the cost of such work. Prior to the commencement of any work by Tenant, Tenant shall obtain the insurance required in Section 4.7 below and all plans and specifications shall be approved by Landlord. Landlord shall have the right, at no expense to Landlord, to require Tenant to furnish Landlord with payment and performance bonds guaranteeing the completion of any such repairs, alterations, additions or improvements. No liens arising out of any work performed, materials furnished or obligations incurred by or for the benefit of Tenant shall exist against the Premises or the Building. The interest of Landlord in the Premises, the Building and the Project shall not be subject to liens for improvements made by or on behalf of Tenant. If any mechanics’, materialmen’s or other lien (each, a “lien”) is filed against the Premises or the Building(s) as a result of Tenant’s actions or inactions, Tenant, at its expense, shall cause the lien to be discharged of record or fully bonded to the satisfaction of Landlord within ten (10) days after notice of the filing thereof. If Tenant fails to discharge or bond against said lien within such ten (10) day period, Landlord may, in addition to any other rights or remedies Landlord may have, but without obligation to do so, bond against or pay the lien without inquiring into the validity or merits of such lien, and all sums so advanced, including reasonable attorneys’ fees, shall be paid by Tenant on demand as Additional Rent. Section 4.5. Tenant’s Signs. Before opening its store, Tenant shall install a sign which shall indicate Tenant’s trade name above the front entrance to the Premises. Tenant’s signage shall at all times be consistent with the signage design criteria for the Shopping Center, including the manner and method of attachment of the signage to the building. Landlord agrees to allow Tenant to install and maintain the maximum signage permitted under applicable Laws. All signs must comply with all Laws, including, but not limited to, any applicable city and county code requirements. Tenant shall be solely responsible for all costs associated with the manufacture, installation and maintenance of the signs. At the expiration of this Lease, Tenant shall remove all signs, at its sole expense, and shall repair any damage resulting from the 8 installation or removal of the signs. Section 4.6. Removal by Tenant. All present and future repairs, alterations, additions and improvements made to the Premises by either party shall become the property of Landlord upon attachment. Upon the expiration or sooner termination of this Lease, Tenant shall not remove any of such alterations, and improvements, except that Tenant shall remove any alterations, additions or improvements that Landlord designates by written notice to Tenant, at the Time of Tenant’s request to make such changes, and Tenant shall remove its trade fixtures if Tenant is not in default hereunder. Tenant shall promptly repair any damage to the Premises caused by such removal. Tenant will not have any restoration obligations related to Landlord’s Work. Section 4.7. Construction Insurance. Prior to the commencement of any Tenant alterations, repairs, additions or improvements to the Premises, Tenant shall carry, or cause its contractor to carry, “Builder’s All Risk” insurance in an amount reasonably approved by Landlord covering the performance of the same, workers’ compensation coverage as required by law, and such other insurance Landlord may reasonably require, and shall provide evidence of such coverage to Landlord. Landlord and any mortgagee of the Building shall be named as additional insureds or loss payees, as applicable on such policies. ARTICLE V CONDUCT OF BUSINESS Section 5.1. Permitted Use. Tenant shall continuously use and occupy the Premises during the Term solely for the purpose of conducting the business specifically set forth in the Summary of Certain Provisions, and for no other purpose. Tenant shall not use the Premises for any use that would conflict with the exclusive use rights of other tenants at the Project, a list of which is attached hereto as Exhibit E. Tenant shall procure all license(s) and/or permit(s) required for the lawful conduct of Tenant’s business and submit the same for inspection by Landlord. Tenant, at Tenant’s expense, shall at all times comply with the requirements of such license(s) or permit(s). Section 5.2. Tenant’s Covenants and Prohibited Uses. Notwithstanding the foregoing, the Tenant: a) Tenant shall at all times keep the Premises at a temperature sufficiently high to prevent freezing of water pipes and fixtures. b) When Shopping Center generally is open for business to the public, Tenant shall maintain the following temperatures in all open merchandising areas in the Premises, subject to any adjustments required by any governmental agency: i. Heating Season: A prevailing minimum temperature of sixty-eight (68) degrees Fahrenheit. ii. Cooling Season: A prevailing maximum temperature of seventy-eight (78) degrees Fahrenheit and relative humidity of approximately sixty (60%) percent. c) Tenant shall not permit any business to be operated in or from the Demised Premises by any concessionaire or licensee without the prior written consent of Landlord. d) Tenant (i) will keep clean the inside and outside of all glass in the doors and windows of the Premises; (ii) will replace promptly at its own expense with glass of like kind and quality any plate or window glass; (iii) will replace doors or door hardware of the Premises which may for any reason become cracked or broken; (iv) will maintain the Premises in a clean, orderly and sanitary condition and free of insects, rodents, vermin, and other pests; (v) will not permit undue accumulation of garbage, trash, rubbish or other refuse in the Premises; and (vi) will keep such refuse in proper containers inside the Premises until such time as same is called for to be removed. 9 e) Tenant shall keep the Premises open for business with the public during all hours when Shopping Center generally is open for business with the public. Tenant shall keep the Premises open for business with the public on each business day at least during the hours indicated below or such extensions of the minimum as shall be determined by Landlord. Lessee shall continuously operate its business in the entire Premises, as required by this Lease during the Term hereof. In no event shall any Tenant be open for business less than thirty (30) hours in any given week. Notwithstanding the provisions of this Section, no Tenant shall be required to keep its Premises open for business on national holidays or at any time prohibited by applicable law, ordinance or governmental regulations and Tenant shall be permitted to close the Premises during reasonable periods not to exceed three (3) consecutive days (but not more than twice in any twelve (12) month period) for re-stocking, taking inventory, repairing, cleaning or decorating the Premises, with prior written permission from Landlord. f) Tenant shall not, nor shall Tenant at any time permit any occupant of the Premises to, (i) conduct or permit any fire, bankruptcy or auction sale (whether real or fictitious) unless directed by order of a court of bankruptcy or of competent jurisdiction, or conduct or permit any fictitious "Going Out of Business" sale; (ii) use, or permit to be used, the malls or sidewalks adjacent to such Premises, or any other area outside the Premises for the sale or display of any merchandise or for any other business, occupation or undertaking, or for outdoor public meetings, circus or other entertainment (except for promotional activities in cooperation with the management of the Shopping Center): (iii) use or permit to be used, any sound broadcasting or amplifying device which can be heard outside of the Premises; (iv) operate or cause to be operated any "elephant trains" or similar transportation devices; (v) use or permit to be used any portion of the Premises for any unlawful purpose or use or permit the use of any portion of the Premises as regular living quarters, sleeping apartments or lodging rooms or for the conduct of any assembly or manufacturing business or warehouse (except as required to store retail goods for sale on site); or (vi) use, operate or maintain the Premises in such manner that any of the rates for any insurance carried by Landlord, or the occupant of any premises within the Shopping Center, shall thereby be increased, unless Tenant shall pay to Landlord or such occupant within the Shopping Center, as the case may be, an amount equal to any such increase in rates, such payment to be made promptly on demand as each premium which shall include such increase shall become due and payable. g) Tenant (i) will not represent or advertise that it regularly or customarily sells merchandise at "manufacturers", "distributor's ", or "wholesale", "warehouse", "fire sale", "bankruptcy sale", surplus, or similar prices or other than at retail prices; (ii) will keep all mechanical apparatus free of vibration or noise which may be transmitted beyond the confines of the Premises; (iii) will not cause or permit objectionable odors to emanate from the Premises; (iv) will not load or unload or permit the loading or unloading of merchandise, supplies or other property except within the area designated by Landlord from time to time; and (v) will not permit the parking or standing, outside of such designated area, of trucks, trailers or other vehicles or equipment engaged in such loading or unloading. Other than those items commonly used in Tenant’s Permitted Use (such as cleaning, food preparation or office supplies). Tenant shall not sell, or suffer or permit to be kept, used or sold in, upon or about the Demised Premises any gasoline, distillate or other petroleum products or any other substance or material of an explosive, inflammable or radiological nature which may endanger any part of the Demised Premises or its occupants, business patrons or invitees, or present any unusual fire, explosion or other damaging or dangerous hazard or possibility of contamination; and Tenant shall comply with all governmental rules, regulations, ordinances, statutes and laws now or hereafter in effect pertaining to the Demised Premises or Tenant's "use" thereof (including such rules and regulations regarding the disposal of medical, toxic and hazardous waste); provided, however, 10 that Tenant shall not be liable for structural or major system changes except as they may be required as a consequence of the nature of Tenant's particular use of the Demised Premises. Section 5.3. Tenant’s Additional Covenants. Tenant covenants and agrees that, in the operation of its business within the Premises, Tenant shall: (a) pay before delinquency any and all taxes, assessments and public charges levied, assessed or imposed upon Tenant’s business, or upon Tenant’s fixtures, furnishings or equipment in the Premises; (b) not use any space outside the Premises for sale, storage, display, hand billing, advertising, solicitation or any other similar undertaking; (c) not use the plumbing facilities in the Premises for any purpose other than that for which they were constructed; (d) not use any advertising medium or sound devices inside or adjacent to the Premises which produce or transmit sounds which are audible beyond the interior of the Premises, except as otherwise approved by Landlord in writing; (e) not permit any odor to emanate from the Premises which is reasonably objected to by Landlord or by any tenant or occupant of the Building (and, upon written notice from Landlord, Tenant shall immediately cease and desist from causing such odor, failing which Landlord may deem the same a material breach of this Lease); (f) not use the Premises in a manner that would constitute a nuisance; (g) keep the Premises in a neat, clean, safe and sanitary condition; (h) be authorized to do business in the State; (i) not store, display, sell or distribute any alcoholic beverages or any dangerous materials other than those items commonly used in Tenant’s Permitted Use (such as cleaning, food preparation or office supplies) or serving alcoholic beverages for employee social events and events for clients; (j) not operate or permit to be operated on the Premises any coin or token operated vending machine or similar device other than vending machines for the exclusive use of Tenant’s employees; (k) not permit any improper, immoral and “adult” entertainment or nudity in the Premises, and not distribute or display any paraphernalia commonly used in the use or ingestion of illicit drugs, or any x-rated, pornographic or so-called “adult” newspaper, book, magazine, film, picture, video tape, video disk or other similar representation or merchandise of any kind; (l) use good faith efforts to avoid any action which would cause any work stoppage, picketing, labor disruption or dispute, or any interference with the business or rights and privileges of Landlord or any other tenant, occupant or other person lawfully in the Project; (m) not interfere with the transmission or reception of microwave, television, or radio communications signals by antennae located on the roof of any building or elsewhere in the Project; (n) not move any safe, heavy machinery, heavy equipment or fixtures into or out of the Premises without Landlord’s prior written consent, or place a load on any floor exceeding the floor load per square foot that such floor was designed to carry, or install, operate or maintain in the Premises any heavy equipment except in such manner as to achieve a proper distribution of weight; and (o) promptly comply with all present and future laws, ordinances, orders, rules, regulations and requirements of all governmental authorities having jurisdiction (collectively, “Laws”), including any and all Laws concerning the Americans with Disabilities Act of 1990, as amended (the “ADA”) (so long as such compliance with all Laws is related to Tenant’s specific use of the Premises and not office use in general), or the generation, use and/or disposal of any Hazardous Materials (as defined in Section 5.5 below) brought to the Premises by Tenant, its employees, agents or contractors, or the cleanliness, safety, occupancy and use of the same, whether or not any such law, ordinance, order, rule, regulation, covenant, restriction or other requirement is substantial, or foreseen or unforeseen, or ordinary or extraordinary, or shall necessitate structural changes or improvements, shall interfere with the use or enjoyment of the Premises, and Tenant shall hold Landlord harmless from any and all cost or expense on account thereof (as used in this Lease, the term “legal requirements” shall include the requirements set forth in this subparagraph 5.3(o)). Section 5.4. Notice by Tenant. Tenant shall give immediate notice to Landlord in case of fire or accidents in the Premises, or in the Building of which the Premises are a part, or of defects therein or in any fixtures or equipment. Section 5.5. Hazardous Materials. (a) Tenant shall not cause or permit the presence, use, generation, release, discharge, storage, disposal or transportation of any Hazardous Materials on, under, in, about, to or from the Premises and/or the Project, other than those items commonly used in Tenant’s Permitted Use (such as cleaning, food 11 preparation or office supplies). As used herein, the term “Hazardous Materials” shall mean any hazardous or toxic substances, materials or waste, pollutants or contaminants, as defined, listed or regulated by any federal, state, county or local law, regulation or order or by common law decision including, without limitation: (i) trichloroethylene, tetrachloroethylene, perchloroethylene and other chlorinated solvents; (ii) petroleum products or by-products; (iii) asbestos; and (iv) polychlorinated biphenyls. (b) Should a release of any Hazardous Materials occur at the Premises or the Project as the result of the acts or omissions of Tenant, Tenant shall immediately (i) notify Landlord and any mortgagee of the Project for whom Tenant has been provided contact information, and (ii) contain, remove and dispose of, off the Premises or the Project, such Hazardous Materials and any material that was contaminated by the release, and remedy and mitigate all threats to human health or the environment relating to such release. When conducting any such measures Tenant shall comply with all environmental laws. (c) Tenant shall exonerate, indemnify, pay and protect, defend (with counsel reasonably approved by Landlord) and hold harmless Landlord, and its directors, trustees, beneficiaries, officers, shareholders, partners, members, managers, employees, agents, and invitees, any mortgagee of the Building and those of the other tenants of the Building (collectively, the “Related Parties”) from and against any claims (including, without limitation, third party claims for personal injury or real or personal property damage), actions, administrative proceedings (including informal proceedings), judgments, damages, punitive damages, penalties, fines, costs, taxes, assessments, liabilities (including sums paid in settlements of claims), interest or losses, including reasonable attorneys’ fees and expenses (including any such fees and expenses incurred in enforcing this Lease or collecting any sums due hereunder), consultant fees, and expert fees, together with all other reasonable costs and expenses of any kind or nature actually incurred (collectively, the “Costs”) that arise directly or indirectly in connection with the presence, suspected presence, release or suspected release of any Hazardous Materials in or into the air, soil, ground water, surface water or improvements at, on, about, under or within the Premises or the Project, or any portion thereof, or elsewhere in connection with the transportation of Hazardous Materials to or from the Premises or the Project, in any such case by or on behalf of Tenant. This indemnification shall survive the termination of this Lease and shall be binding upon Tenant and its successors in interest whenever such threat, claim or cause of action may arise. Tenant expressly waives any defense concerning laches or the statute of limitations, constructive eviction or rent abatement with respect to such claims. Tenant's obligations under this Section 5.5 shall survive the termination of this Lease for any reason whatsoever. (d) Landlord shall exonerate, indemnify, pay and protect, defend (with counsel reasonably approved by Tenant) and hold harmless Tenant, and its directors, trustees, beneficiaries, officers, shareholders, partners, members, managers, employees, agents, and invitees, any mortgagee of the Building and those of the other tenants of the Building (collectively, the “Related Parties”) from and against any claims (including, without limitation, third party claims for personal injury or real or personal property damage), actions, administrative proceedings (including informal proceedings), judgments, damages, punitive damages, penalties, fines, costs, taxes, assessments, liabilities (including sums paid in settlements of claims), interest or losses, including reasonable attorneys’ fees and expenses (including any such fees and expenses incurred in enforcing this Lease or collecting any sums due hereunder), consultant fees, and expert fees, together with all other reasonable costs and expenses of any kind or nature actually incurred (collectively, the “Costs”) that arise directly or indirectly in connection with the presence, suspected presence, release or suspected release of any Hazardous Materials in or into the air, soil, ground water, surface water or improvements at, on, about, under or within the Premises or the Project, or any portion thereof, or elsewhere in connection with the transportation of Hazardous Materials to or from the Premises or the Project, in any such case by or on behalf of Landlord. This indemnification shall survive the termination of this Lease and shall be binding upon Landlord and its successors in interest whenever such threat, claim or cause of action may arise. Landlord's obligations under this Section 5.5 shall survive the termination of this Lease for any reason whatsoever. 12 ARTICLE VI OPERATING EXPENSES Section 6.1 Operating Expense Payments. Commencing on the Commencement Date, and thereafter during each Lease Year throughout the Term, Tenant shall pay to Landlord Tenant’s Share of the Operating Expenses incurred in the operation of the Shopping Center for each Lease Year, whether or not such cost or expense is incurred or performed on the Shopping Center Land. “Operating Expenses” means all costs and expenses necessary to own, operate and maintain the Shopping Center in sole discretion of the Landlord and all “Common Areas”, including, without limitation and by example only: all costs and expense of operating the Common Areas, all personnel costs (for persons below the grade of Building manager) and all other costs associated with the operation of the Shopping Center, maintaining, repairing, lighting, signing, roof, cleaning, painting, striping, utilities (including, without limitation, electric, gas, water, and sewer), insurance (including, without limitation, Landlord’s insurance costs for fire and casualty, loss of rents, and liability insurance of the Shopping Center), costs otherwise payable by Landlord pursuant to any Permitted Exceptions, repairs, replacement costs (due to ordinary or extraordinary wear and tear or catastrophe), real estate taxes, trash removal, snow/ice removal and hurricane debris removal (including removal from parking areas, abutting roadways and walkways), landscaping and lawn maintenance, painting, sign installation and maintenance, repair and replacement of utility systems, depreciation of machinery and equipment used in such repair and replacement, cost of all personnel to implement such services below the grade of Building manager; costs and expenses of replacement of paving, curbs, walkways, landscaping, drainage, pipes, ducts, conduits, and similar items and lighting facilities; cost of water; services, if any, furnished by Landlord for nonexclusive use of all tenants; parcel pickup and delivery services; reasonable property management fees; security services as Landlord may provide; and administrative costs equal to ten percent (10%) of the total cost of operating and maintaining the Common Areas as is described above in this Section 6.1 of the lease. The foregoing list of items is provided for illustrative purposes only and shall not be deemed a full, complete or exhaustive list of all possible Operating Expenses. Notwithstanding anything to the contrary, Operating Expenses shall not include: (a) the cost of capital improvements; (b) depreciation; (c) principal payments, late payments, interest or other payments of mortgage and other non-operating debts of Landlord; (d) the cost of repairs or other work to the extent Landlord is reimbursed by insurance or condemnation proceeds; (e) costs in connection with leasing space in the Building; (f) lease concessions, rental abatements and construction allowances granted to specific tenants; (g) costs incurred in connection with the sale, financing or refinancing of the Building; (h) fines, interest and penalties incurred due to the late payment of Taxes or Expenses by Landlord; (i) organizational expenses associated with the creation and operation of the entity which constitutes Landlord; (j) any penalties or damages that Landlord pays to Tenant under this Lease or to other tenants in the Building under their respective leases; (k) real estate brokers’ leasing commissions; (l) costs of other services or work performed for the singular benefit of another tenant or occupant (other than for Common Areas of the Building) and either not available to Tenant or provided to Tenant only for an additional fee (in addition to its payment of a share of Operating Expenses); (m) any inheritance, estate, succession, transfer, gift, franchise, corporation, income, gains or profit tax or capital levy; (n) rental under any ground lease; Section 6.2. Signage. At Tenant’s sole cost and expense, Tenant shall have the right to place a sign on the Building in compliance with the terms of Section 4.5 above and Exhibit D attached hereto. Tenant shall have the right to place a sign that complies with the terms of Exhibit D on the “Retail” monument at Landlord’s sole discretion, pending availability. 13 ARTICLE VII REPAIRS AND MAINTENANCE BY TENANT Section 7.1. Repairs and Maintenance by Tenant. (a) Except to the extent of the work to be performed pursuant to Sections 4.1 and 4.3 above, by entry hereunder Tenant accepts the Premises as being in the condition in which Landlord is obligated to deliver the Premises. Except for those items which Landlord is responsible pursuant to subsection (e) below, Tenant shall, at Tenant's sole cost and expense, at all times during the term hereof keep, and at the end of the term of this Lease surrender to Landlord, the Premises and every part thereof and all alterations, additions and improvements thereto in good condition and repair, except for normal wear and tear and damage (which damage shall not have been caused by the negligence or intentional act of Tenant or its agents, employees, contractors, invitees, licensees, tenants or assigns) thereto by fire, earthquake, act of God or the elements. To the fullest extent permitted by law, Tenant hereby waives all rights to make repairs at the expense of Landlord or in lieu thereof to vacate the Premises as may be provided by any law, statute or ordinance now or hereafter in effect. Landlord has no obligation and has made no promise to alter, remodel, improve, repair, decorate or paint the Premises or any part thereof, except as specifically and expressly herein set forth. No representations respecting the condition of the Premises or the Building have been made by Landlord to Tenant, except as specifically and expressly herein set forth. (b) Tenant agrees that Tenant’s use of electrical current will at no time exceed the capacity of the electric distribution system and that Tenant will not make any alteration or addition to Tenant’s electrical system without Landlord’s prior written consent, not to be unreasonably withheld, conditioned or delayed. (c) If, in each case, following applicable notice and expiration of cure period, Tenant fails, refuses or neglects to properly maintain the Premises, or to commence or to complete repairs promptly and adequately, or if Landlord finds it necessary to make any repairs or replacements otherwise required to be made by Tenant, then Landlord may, after reasonable advance notice to Tenant, in addition to all other remedies, but without obligation to do so, enter the Premises and proceed to have such maintenance, repairs or replacements made, and Tenant shall pay to Landlord, on demand, the cost and expenses therefor plus a charge of five percent (5%) of such costs and expenses to compensate Landlord for its administrative and overhead costs. (d) Tenant shall throughout the term of the Lease and at Tenant’s sole cost and expense maintain a quarterly HVAC maintenance agreement with a reputable HVAC contractor with specific treatments designed to preserve and sustain the longevity of HVAC units near the Ocean. Upon request from the Landlord Tenant shall provide the latest HVAC maintenance report along with documentation evidencing this agreement, or another agreement satisfactory to Landlord has been in full force and effect for the entirety of the term of the lease. (e) Landlord, as a part of Operating Expenses, shall keep, maintain, and repair the structural components of the Building, including the exterior walls, foundations, and roof (exclusive of all glass, exterior doors and store fronts) in good repair, except that repairs rendered necessary by the acts or omissions of Tenant, Tenant’s agents, employees or invitees shall be the responsibility of Tenant. Landlord shall keep and maintain, or cause to be kept and maintained, the Common Areas at all times in good and clean, first class and reputable condition. ARTICLE VIII [INTENTIONALLY DELETED] ARTICLE IX INSURANCE, INDEMNITY AND LIABILITY Section 9.1. Landlord’s Insurance Obligations. Landlord agrees to obtain and maintain during the Term hereof, to the extent that the same is available, (i) fire and extended coverage insurance, in 14 amounts and coverages and with such special endorsements as Landlord shall determine from time to time, insuring the Building in which the Premises is located and the improvements to the Premises provided by Landlord pursuant to this Lease (exclusive of Tenant’s trade fixtures, furnishings, equipment, plate glass, signs and personal property); and (ii) a commercial general liability insurance with respect to the Project, with such policy to be in the minimum amount of One Million Dollars ($1,000,000.00) per occurrence, and with an aggregate limit of at least Three Million Dollars ($3,000,000.00). Landlord shall have the right to carry its insurance under “blanket policies” covering the Building and other properties. Section 9.2. Tenant’s Insurance Obligations. (a) Tenant, at Tenant’s sole cost and expense, shall obtain and maintain in effect, commencing with the delivery of possession date and continuing throughout the Term, insurance policies providing for the following coverage: (i) standard “special form” property insurance against fire, theft, vandalism, malicious mischief, sprinkler leakage and such additional perils as now are or hereafter may be included in a standard extended coverage endorsement from time to time in general use in the State, insuring Tenant’s merchandise, trade fixtures, furnishings, equipment and all items of personal property of Tenant located in, on or about the Premises, and the amount of such insurance will be set forth in an “agreed value endorsement” to the policy of such insurance, not less than one hundred percent (100%) of the full replacement value thereof without deduction for depreciation, and with a deductible amount of not more than Twenty Thousand Dollars ($20,000.00); (ii) a commercial general liability policy, naming Landlord and any mortgagee of the Building as additional insureds, protecting against any and all claims for injury to persons or property occurring in the Premises and protecting against assumed or contractual liability under this Lease with respect to the Premises and the operations of Tenant and any subtenant of Tenant in, on or about the Premises, with such policy to be in the minimum amount of One Million Dollars ($1,000,000.00) per occurrence, and with an aggregate limit of at least Two Million Dollars ($2,000,000.00)) (provided that such aggregate limit may be satisfied by a combination of primary and excess/umbrella coverage); (iii) workers’ compensation coverage as required by law, with employer’s liability limits in the minimum amount of Five Hundred Thousand Dollars ($500,000.00); (iv) and with respect to alterations, improvements and the like required or permitted to be made by Tenant hereunder, contingent liability and builder’s risk insurance in amounts reasonably satisfactory to Landlord. (b) All insurance policies herein to be procured by Tenant and/or its contractors shall: (i) be issued by insurance companies, reasonably satisfactory to Landlord and authorized to do business in the State; (ii) be written as primary policy coverage and non-contributing with respect to any coverage which Landlord may carry; (iii) insure and name Landlord, Landlord’s advisors, Landlord’s managing agent and any parties in interest designated by Landlord as additional insureds or loss payees, as applicable, as their respective interests may appear (except with respect to workers’ compensation insurance); (iv) be primary and non-contributory and (v) contain, in the case of Tenant’s property insurance coverage, an express waiver of any right of subrogation by the insurance company against Landlord, Landlord’s managing agent and their respective agents, employees and representatives which arises or might arise by reason of any payment under such policy or by reason of any act or omission of Landlord, its agents, employees or representatives. The minimum limits of Tenant’s commercial general liability policy of insurance shall be subject to reasonable increases at any time, and from time to time, if Landlord reasonably deems it necessary for adequate protection and if the minimum limits are less than those customarily required for buildings of similar class and size in the Jacksonville area. Within thirty (30) days after demand therefor by Landlord, Tenant shall furnish Landlord with evidence of Tenant’s compliance with such demand. Neither the issuance of any insurance policy required hereunder nor the minimum limits specified herein with respect to Tenant’s insurance coverage shall be deemed to limit or restrict in any way Tenant’s liability arising under or out of this Lease. With respect to each and every one of the insurance policies herein required to be procured by Tenant, on or before the Commencement Date (or, if earlier, the date on which possession of the Premises is delivered to Tenant), and at least thirty (30) days before any such insurance policy shall expire, Tenant shall deliver to Landlord a certificate of the insurer certifying that such policy has been issued, providing the coverage required by this Lease and containing the provisions specified herein, together with evidence of payment of all applicable premiums. Each and every insurance policy required to be carried hereunder by or on behalf of Tenant shall provide (and any certificate evidencing the existence of each such 15 insurance policy shall certify) that, unless Landlord shall first have been given such prior written notice thereof, the insurer will not cancel, materially change or fail to renew the coverage provided by such insurance policy as is required under the applicable policy. The term “insurance policy” as used herein shall be deemed to include any extensions or renewals of such insurance policy. In the event that Tenant shall fail to promptly furnish any insurance coverage hereunder required to be procured by Tenant, Landlord, at its sole option, shall have the right after ten (10) days’ prior written notice to Tenant to obtain the same and pay the premium therefor for a period not exceeding one (1) year in each instance, and the premium so paid by Landlord shall be immediately due and payable by Tenant to Landlord as Additional Rent. (c) Tenant shall not do or permit to be done any act or thing upon the Premises that will invalidate or be in conflict with any fire insurance policies covering the Building or any part thereof, including any retail stores located there, or fixtures and property therein, or any other insurance policies or coverage referred to above in this Article IX; and Tenant shall promptly comply with all rules, orders, regulations or requirements relating to such insurance policies, and shall not do anything, or prevent anything to be done, in, on or about the Premises, or bring or keep anything therein, which shall increase the rate of fire insurance on the Building in which the Premises is located or on any property, including the common areas, located therein, or increase the rate or rates of any other insurance referred to hereinabove. If any act or omission of Tenant, its agents, employees or contractors shall result in any increase in the premium rates applicable to any such insurance policies carried by Landlord, or other increased costs to Landlord in connection therewith, then Tenant shall reimburse Landlord on demand as Additional Rent for the amount of any such increased rates or costs. In particular, if Tenant uses the Premises for the preparation of food, Tenant shall reimburse Landlord on demand for any part of the premium for insurance coverage under Section 9.1 above required to be paid on account of such use of the Premises. Section 9.3. Waiver of Subrogation. LANDLORD AND TENANT HEREBY WAIVE AND RELEASE ANY CLAIM THAT EITHER OF THEM MAY HEREAFTER HAVE AGAINST THE OTHER ON ACCOUNT OF ANY DAMAGE TO THE PROPERTY OF THE WAIVING PARTY, EVEN IF SUCH DAMAGE SHALL BE DUE TO THE NEGLIGENT ACT OR OMISSION OF THE OTHER PARTY, TO THE EXTENT THAT SUCH DAMAGE IS COVERED BY INSURANCE (OR WOULD HAVE BEEN COVERED IF THE INSURANCE REQUIRED HEREUNDER HAD BEEN OBTAINED BY THE PARTY WHO SUFFERED THE DAMAGE). LANDLORD AND TENANT SHALL EACH CAUSE THEIR RESPECTIVE PROPERTY INSURANCE POLICIES TO CONTAIN EITHER A WAIVER OF ANY RIGHT OF SUBROGATION THE INSURER OF ONE PARTY HERETO MAY ACQUIRE AGAINST THE OTHER PARTY HERETO BY VIRTUE OF PAYMENT OF ANY LOSS UNDER ANY SUCH INSURANCE OR AN ACKNOWLEDGMENT BY THE INSURER THAT THE FOREGOING WAIVER OF CLAIMS DOES NOT IMPAIR OR INVALIDATE SUCH POLICY OF INSURANCE. Section 9.4. Covenant to Hold Harmless. EXCEPT TO THE EXTENT OF LANDLORD’S GROSS NEGLIGENCE OR WILFUL MISCONDUCT, TENANT HEREBY INDEMNIFIES AND AGREES TO SAVE HARMLESS LANDLORD, ITS OFFICERS, DIRECTORS, PARTNERS, MEMBERS, MANAGERS, EMPLOYEES AND AGENTS AND ANY MORTGAGEE OR MASTER LESSOR OF THE BUILDING, FROM AND AGAINST ANY AND ALL CLAIMS, ACTIONS, DAMAGES, LIABILITIES, COSTS AND EXPENSES, INCLUDING REASONABLE ATTORNEYS’ FEES, THAT (A) ARISE FROM OR ARE IN CONNECTION WITH THE POSSESSION, USE, OCCUPANCY, MANAGEMENT, REPAIR, MAINTENANCE OR CONTROL OF THE PREMISES, OR ANY PORTION THEREOF BY TENANT, OR (B) ARISE FROM OR ARE IN CONNECTION WITH ANY NEGLIGENCE OR WILLFUL MISCONDUCT OF TENANT OR TENANT’S AGENTS, EMPLOYEES, CONTRACTORS, LICENSEES OR INVITEES, OR (C) RESULT FROM ANY DEFAULT, BREACH, VIOLATION OR NONPERFORMANCE OF THIS LEASE OR ANY PROVISION HEREOF BY TENANT, OR (D) RESULT FROM INJURY TO PERSON OR PROPERTY OR LOSS OF LIFE SUSTAINED IN THE PREMISES. TENANT SHALL, AT ITS OWN COST AND EXPENSE, DEFEND ANY AND ALL ACTIONS, SUITS AND PROCEEDINGS WHICH MAY BE BROUGHT AGAINST LANDLORD OR ANY MORTGAGEE OR MASTER LESSOR OF THE BUILDING WITH RESPECT TO THE FOREGOING. TENANT SHALL PAY, SATISFY AND DISCHARGE ANY AND 16 ALL JUDGMENTS, ORDERS AND DECREES WHICH MAY BE RECEIVED AGAINST LANDLORD OR ANY SUCH MORTGAGEE OR MASTER LESSOR IN CONNECTION WITH THE FOREGOING. IN THE EVENT LANDLORD OR ANY OTHER PARTY SO INDEMNIFIED SHALL, WITHOUT FAULT, BE MADE A PARTY TO ANY LITIGATION COMMENCED BY OR AGAINST TENANT, OR IF LANDLORD OR ANY SUCH PARTY SHALL, IN ITS SOLE DISCRETION, INTERVENE IN SUCH LITIGATION TO PROTECT ITS INTEREST HEREUNDER, THEN TENANT SHALL PROTECT AND HOLD THEM HARMLESS AND SHALL PAY ALL COSTS, EXPENSES AND REASONABLE ATTORNEYS’ FEES INCURRED OR PAID BY SUCH PARTY(IES) IN CONNECTION WITH SUCH LITIGATION. Section 9.5. Consequential Damages. NEITHER LANDLORD NOR TENANT SHALL BE LIABLE UNDER ANY CIRCUMSTANCES FOR SPECIAL, CONSEQUENTIAL OR PUNITIVE DAMAGES, OR LOST PROFITS, FOR ANY BREACH OF THE TERMS HEREIN. ARTICLE X DESTRUCTION OF PREMISES Section 10.1. Casualty. (a) If the Premises is damaged or destroyed by fire or other casualty Landlord shall deliver Tenant written notice stating the estimated period of time for landlord to rebuild. If neither party elects to terminate this Lease as hereinafter provided, Landlord shall proceed with reasonable diligence and at its sole cost and expense to rebuild and repair the Premises. If (i) more than fifty percent (50%) of the square footage of the Premises shall be damaged by any fire or other casualty during the last two (2) years of the Term of this Lease (not including any option or renewal periods) or during any renewal or extension of the Term hereof, or (ii) Landlord is unable to rebuild any portion of the Building due to any inability to obtain any required governmental approval in connection therewith, or (iii) more than fifty percent (50%) of the floor area of the Building shall be damaged or destroyed by fire or other casualty, or (iv) if all or any part of the Building or the Premises shall be damaged or destroyed at any time by the occurrence of any risk not insured under the insurance required to be carried under Article IX above, or (v) for any reason whatsoever sufficient insurance proceeds are not available (including, without limitation, by the exercise of the right of any mortgagee of the Building to apply insurance proceeds to any obligations of Landlord to such mortgagee), then Landlord shall have the option to terminate this Lease by giving written notice to Tenant. Landlord shall give written notice to Tenant of such election within ninety (90) days after the occurrence of such casualty and if it elects to rebuild and repair shall proceed to do so with reasonable diligence and at its sole cost and expense. Tenant hereby waives any and all rights that it may have to terminate this Lease by reason of damage to the Premises by fire or other casualty pursuant to any presently existing or hereafter enacted statute or pursuant to any other law. Tenant may elect to terminate this Lease by notice to Landlord if substantial completion of restoration of the Premises or of the access thereto does not occur within two hundred seventy (270) days after the date of such damage or destruction, or if Landlord gives Tenant notice that Landlord has determined that substantial completion of restoration of the Premises or of the access thereto shall take longer than two hundred seventy (270) days after the date of such damage or destruction; provided, however, that in such event such two hundred seventy (270) day period shall be automatically extended (x) for so long as Landlord is diligently pursuing the settlement of any insurance claims for such casualty and the performance of the applicable restoration work, and (y) by any period of Force Majeure. (b) Landlord’s obligation to rebuild and repair under this Article X shall in any event be limited to restoring the Premises to substantially the same condition in which the same existed prior to the casualty. In no event shall Landlord be required to repair or replace Tenant’s merchandise, trade fixtures, furnishings or equipment. Tenant agrees that promptly after completion of such work by Landlord Tenant shall proceed with reasonable diligence and at Tenant’s sole cost and expense to restore, repair and replace all alterations, additions, improvements, fixtures, signs and equipment installed by Tenant to substantially the same condition in which the same existed prior to the casualty. 17 (c) Tenant agrees that during any period of reconstruction or repair of the Premises it shall continue the operation of its business within the Premises to the extent practicable. During the period from the occurrence of the casualty until Landlord’s repairs are completed, Tenant shall be entitled to a pro rata reduction in the Minimum Rent payable based on the proportion which the Rentable Area of the Premises impacted bears to the entire rentable Area of the Premises immediately prior to such casualty; however, there shall be no abatement of the Additional Rent, and other charges provided for herein nor shall there be any abatement of Rent in the event the underlying damage was caused by Tenant, or its contractors, subcontractors, employees, agents or invitees. ARTICLE XI CONDEMNATION Section 11.1. Eminent Domain. If twenty percent (20%) or more of the floor area of the Premises shall be taken or condemned by any governmental authority (including, for purposes of this Article, any purchase by such governmental authority in lieu of a taking), or if access to or parking for the Premises is materially adversely affected, either party may elect to terminate this Lease by giving notice to the other party not more than sixty (60) days after the date on which such title shall vest in the authority. If the parking area is reduced below the minimum parking requirements imposed by the applicable authorities, rendering the use of the Premises in violation of law, either party may elect to terminate this Lease by giving Tenant notice within one hundred twenty (120) days after such taking. In the case of any taking or condemnation, whether or not the Term shall cease and terminate, the entire award shall be the property of Landlord; provided, however, Tenant shall be entitled to any award as may be made for trade fixtures and other equipment which under the terms of this Lease would not have become the property of Landlord; further provided, that any such award to Tenant shall not be in diminution of any award otherwise to be made to Landlord in the absence of such award to Tenant. Section 11.2. Rent Apportionment. In the event of any taking or condemnation, the then current Minimum Rent and the Rentable Area of the Premises shall be apportioned as of the date when possession of the Premises is required to be delivered to the condemning authority or termination of this Lease and Tenant shall be entitled to a pro rata reduction in the Minimum Rent payable based on the proportion which the Rentable Area taken from the Premises bears to the entire Rentable Area of the Premises immediately prior to such taking. ARTICLE XII ASSIGNMENT, SUBLETTING AND ENCUMBERING LEASE Section 12.1. No Assignment, Subletting or Encumbering of Lease. (a) Notwithstanding any references to assignees, subtenants, concessionaires or other similar entities in this Lease, Tenant shall not (i) assign or otherwise transfer, or mortgage or otherwise encumber this Lease or any of its rights hereunder, or (ii) sublet the Premises, or (iii) permit the use of the Premises or any part thereof by any persons other than Tenant or its agents without Landlord’s prior written consent, which consent shall not be unreasonably withheld, conditioned or delayed. Any such attempted or purported transfer, assignment, mortgaging or encumbering of this Lease or any of Tenant’s interest hereunder, and any attempted or purported subletting or grant of a right to use or occupy all or a portion of the Premises in violation of the foregoing sentence, whether voluntary or involuntary or by operation of law or otherwise, shall be null and void and shall not confer any rights upon any purported transferee, assignee, mortgagee or occupant. Nothing contained elsewhere in this Lease shall authorize Tenant to enter into any franchise, concession, license, permit, subtenancy, departmental operation arrangements or the like, except pursuant to the provisions of this Article XII. (b) Notwithstanding the provisions of Sections 12.1(a), Tenant shall have the right to assign this Lease or to sublet the Premises (in whole or in part) to any other entity (the “Successor Entity”) (i) which controls or is controlled by Tenant or Tenant’s parent corporation or which is under common control with Tenant, provided that such transfer or transaction is for a legitimate regular business purpose of Tenant other than a transfer of Tenant’s interest in this Lease, or (ii) which purchases all or substantially all of the assets of Tenant, 18 or (iii) which purchases all or substantially all of the stock of (or other ownership or membership interests in) Tenant or (iv) which merges or combines with Tenant, provided that in any of the foregoing events, the entity to which this Lease is so assigned or which so sublets the Premises has a credit worthiness (e.g., net assets on a pro forma basis using generally accepted accounting principles consistently applied and using the most recent financial statements) and cash flow which are reasonably adequate to satisfy the obligations under the Lease through the end of the term hereof (the foregoing transferees referred to, individually or collectively, as a “Permitted Transferee”). Except in cases of statutory merger, in which case the surviving entity in the merger shall be liable as the Tenant under this Lease, Tenant shall continue to remain fully liable under this Lease, on a joint and several basis with the Permitted Transferee. If any parent, affiliate or subsidiary of Tenant to which this Lease is assigned or the Premises sublet (in whole or in part) shall cease to be such a parent, affiliate or subsidiary, such cessation shall be considered an assignment or subletting requiring Landlord’s consent. (c) Without conferring any rights upon Tenant not otherwise provided in this Article XII, should Tenant desire to enter into an assignment, sublease or transfer of this Lease or Tenant’s rights hereunder, Tenant shall request in writing Landlord’s consent to the assignment, sublease or transfer at least thirty (30) days before the proposed effective date of the assignment, sublease or transfer, providing the following: (i) the full particulars of the proposed assignment, sublease or transfer of this Lease or Tenant’s rights hereunder, including its nature, effective date, terms and conditions, and copies of any offers, draft agreements, subleases, letters of commitment or intent and other documents pertaining to the proposed transfer; (ii) a description of the identity, net worth of the proposed transferee, including (without limitation) copies of the proposed transferee’s latest income, balance sheet and changes in financial position statements (with accompanying notes and disclosures of all material changes thereto) in audited form, if available, and certified as accurate by the proposed transferee; and (iii) any further information relevant to the proposed transfer which Landlord shall request after receipt of Tenant’s request for consent. Tenant shall, concurrently with any request for Landlord’s consent, pay to Landlord a fee in the sum of Five Hundred Dollars ($500.00) for Landlord’s review and processing of such request, and Landlord shall not be obligated to review such request prior to Landlord’s receipt of such fee. Landlord, after receiving such request, shall have a thirty (30) day period in which to provide written notice to Tenant informing Tenant that Landlord approves the transfer (with or without conditions), disapproves the transfer or will elect to recapture the Premises as provided for in Section 12.4 below. The consent by Landlord to any proposed assignment or sublease shall not release Tenant from any covenant or obligation under this Lease, nor be deemed a waiver or release of the non-assignability covenants in their future application, nor shall the collection or acceptance of rent from any such assignee, transferee, subtenant or occupant constitute a waiver of or a release of Tenant from any covenant or obligation contained in this Lease. (d) Without conferring any rights upon Tenant not otherwise provided in this Article XII, in the event of an assignment or transfer of Tenant’s interest in this Lease, or a sublease of all or a portion of the Premises, to a third party, in the event that any monthly rent or other payment accruing to Tenant as the result of any such assignment, transfer, or sublease, including any lump sum or periodic payment in any manner relating to such assignment, transfer or sublease, is in excess of the rent then payable by Tenant under this Lease, then one-half of such excess shall be paid by Tenant to Landlord monthly as Additional Rent. Landlord may require a certificate from Tenant specifying the full amount of any such payment of whatsoever nature. (e) All reasonable out-of-pocket costs and expenses, including attorneys’ fees incurred by Landlord in connection with any proposed or purported assignment, transfer or sublease shall be borne by Tenant and shall be payable to Landlord as Additional Rent, less the $500.00 fee payable pursuant to subsection (c) above. Section 12.2. Assignment or Sublet. If this Lease is transferred or assigned, as aforesaid, or if the Premises or any part thereof shall be sublet or occupied by any person or entity other than Tenant, whether as a result of any act or omission by Tenant, or operation of law, or otherwise, then Landlord, whether before or after default by Tenant, may, in addition to, and not in diminution of or substitution for, any other rights and remedies under this Lease or pursuant to law to which Landlord may be entitled as a result thereof, collect rent from the transferee, assignee, subtenant or occupant and apply the net amount collected to the rent herein reserved, but 19 no such transfer, assignment, subletting, occupancy or collection shall be deemed a waiver of the covenants contained herein, or the acceptance of the transferee, assignee, subtenant or occupant as the tenant hereunder, or a release of Tenant from the further performance by Tenant of covenants on the part of Tenant set forth in this Lease. Unless and until Landlord exercises its right pursuant to the immediately-preceding sentence, Tenant shall be entitled to collect rentals payable under approved subleases. Section 12.3. Transfer of Landlord’s Interest. In the event of any transfer of Landlord’s interest in the Premises, including a sale or lease, the transferor shall be automatically relieved of any and all obligations on the part of Landlord accruing from and after the date of such transfer, provided that (a) the interest of the transferor, as Landlord, in any funds then in the hands of Landlord in which Tenant has an interest shall be turned over, subject to such interest, to the transferee; and (b) notice of such sale, transfer or lease shall be delivered to Tenant as required by law. Section 12.4. Recapture of Premises. In the event Tenant proposes to assign its interest in this Lease or sublet more than fifty percent (50%) of the Premises, it shall first give notice thereof (the “Assignment/Subletting Notice”) to Landlord together with all other information requested by Landlord with respect to the subject assignment or subletting. Within twenty-one (21) days after Landlord’s receipt of an Assignment/Subletting Notice and such required and/or requested information from Tenant, and provided that the subject assignment or sublease is not one permitted without the prior consent of Landlord, Landlord may elect by notice (the “Recapture Termination Notice”) in writing to Tenant to terminate this Lease and recapture the Premises, in which event this Lease shall automatically terminate on the ninetieth (90th) day (the “Termination Date”) following Tenant’s receipt of the Termination Notice with the same force and effect as if said Termination Date had been designated as the expiration date of this Lease, and Landlord and Tenant shall upon such Termination Date be released from any and all liabilities thereafter accruing hereunder. All Minimum Rent and Additional Rent payable by Tenant hereunder shall be apportioned as of the Termination Date and Tenant shall promptly pay to Landlord any amounts so determined to be due and owing by Tenant to Landlord, and conversely Landlord shall promptly reimburse Tenant for any amounts prepaid by Tenant for periods subsequent to the Termination Date. Notwithstanding any Termination Notice given to Tenant by Landlord within the aforesaid twenty-one (21) day period, Tenant shall have the right within ten (10) days after its receipt of the Termination Notice to give Landlord notice (the “Rescission Notice”) of its rescission of the Assignment/Subletting Notice, and upon Landlord’s receipt of the Rescission Notice the Termination Notice previously given by Landlord shall be deemed null and void; in such event, Tenant shall not assign this Lease or sublet the Premises as proposed in its Assignment/Subletting Notice. The above recapture rights shall not apply to an assignment or sublet permitted under Section 12.1(b) above. Section 12.5. Continuing Liability. No assignment, subletting or other transfer or encumbrance of Tenant’s interest under this Lease shall reduce, diminish or otherwise affect the liability of Tenant hereunder. ARTICLE XIII SUBORDINATION, ATTORNMENT, FINANCING AND ESTOPPEL CERTIFICATE Section 13.1. Subordination. Tenant agrees that this Lease shall be subordinate to any mortgages that are now, or may hereafter be, placed upon the Building or any portion thereof and to any and all advances to be made thereunder, and to interest thereon, and all amendments, modifications, renewals, replacements and extensions thereof, provided that the mortgagees or beneficiaries named in said mortgages or trust deeds shall agree to recognize the interest of Tenant under this Lease in the event of foreclosure, if Tenant is not then in default. Tenant also agrees that any mortgagee or beneficiary may elect to have this Lease constitute a prior lien to its mortgage, and in the event of such election and upon notification by such mortgagee or beneficiary to Tenant to that effect, this Lease shall be deemed prior in lien to such mortgage, whether this Lease is dated prior to or subsequent to the date of said mortgage. Tenant further agrees that this Lease shall be subordinate to any ground leases or underlying leases (including, without limitation, any lease entered into in connection with any public financing) that are now, or may hereafter be, placed upon the Building or any portion thereof and all amendments, modifications, renewals, replacements and extensions thereof. Tenant also agrees that any ground 20 lessor or underlying lessor may elect to have this Lease constitute a prior lien to its ground lease or underlying lease, and in the event of such election and upon notification by such ground lessor or underlying lessor to Tenant to that effect, this Lease shall be deemed prior in lien to such ground lease or underlying lease, whether this Lease is dated prior to or subsequent to the date of said ground lease or underlying lease. Tenant’s acknowledgment and agreement of subordination provided for in this Section 13.1 is self-operative, and no further instrument of subordination shall be required; however, Tenant agrees that within ten (10) days of the request of Landlord, from time to time, Tenant shall execute a written Subordination, Non-Disturbance and Attornment Agreement (the “SNDA”), in reasonable form, or whatever other reasonable instruments may be required to carry out the intent of this Section. Tenant agrees to simultaneously give to any mortgagee of the Building by registered or certified mail, a copy of any notice of default served upon Landlord provided that Tenant has been notified in writing of the names and addresses of such mortgagee(s) (the execution and delivery of the SNDA shall constitute such notice to Tenant) and such parties shall have the same cure rights as Landlord has under this Lease. Any reference in this Article XIII to a “mortgage” or “mortgagee” shall also be deemed to mean a deed to secure debt and the holder thereof, respectively. Notwithstanding anything to the contrary contained in this section, (i) Landlord agrees to use commercially reasonable efforts to obtain a SNDA in form reasonably acceptable to Tenant from the holder of any existing or future mortgage on the Building, and (ii) with respect to the holder of any future mortgage on the Building, the subordination provisions set forth herein shall not be effective until Tenant receives an SNDA from such future mortgagee. Section 13.2. Attornment. In the event any proceedings are brought for the foreclosure of, or in the event of the conveyance by deed in lieu of foreclosure of, or in the event of exercise of the power of sale under, any mortgage or other security instrument made by Landlord affecting the Building or any portion thereof, or in the event that Landlord sells, conveys or otherwise transfers its interest in the Building or any portion thereof, or in the event a ground lease or underlying lease affecting the Premises is terminated, this Lease shall remain in full force and effect and at the option of the new owner (or lessor, as applicable), Tenant shall attorn to, and hereby covenants and agrees to execute an instrument in writing reasonably satisfactory to the new owner (or lessor, as applicable) upon the request of new owner (or lessor, as applicable) whereby Tenant attorns to such successor-in-interest and recognizes such successor-in-interest as the Landlord under this Lease. Payment by or performance of this Lease by any person, firm or corporation claiming an interest in this Lease or the Premises by, through or under Tenant without Landlord’s (or such new owner’s, as applicable) consent in writing shall not constitute an attornment or create any interest in this Lease or the Premises. If any mortgage is foreclosed, or Landlord’s interest under this Lease is conveyed or transferred in lieu of foreclosure: neither the mortgagee nor any person or entity acquiring title to the Building as a result of foreclosure or trustee’s sale, nor any successor or assign of either of the foregoing, shall be (i) liable for or obligated to cure any default by Landlord or liable for any act or omission of Landlord (except those of a continuing nature), (ii) bound by or liable for any payment of Rent which may have been made more than thirty (30) days before the due date of such installment, (iii) subject to any defense or offset which Tenant may have to the payment of Rent or other performance under this Lease arising from any default by Landlord (except for those abatement rights, if any, expressly set forth in this Lease), (iv) bound by any amendment or modification to this Lease made without the consent of such mortgagee or (v) bound by any warranty or representation of Landlord relating to work performed by Landlord under this Lease. Section 13.3. Estoppel Certificate. Tenant shall, without charge therefor, within ten (10) business days after request by Landlord or any mortgagee of the Building, execute and deliver to Landlord, a written estoppel certificate, in reasonable form, certifying to Landlord, any mortgagee, or any purchaser of the Building or any other person designated by Landlord, as of the date of such estoppel certificate: (a) that Tenant is in possession of the Premises and has unconditionally accepted the same (or stating the conditions if applicable); (b) that this Lease is unmodified and in full force and effect (or if there have been modifications, that the same is in full force and effect as modified and setting forth such modifications); (c) whether or not there are then existing any set-offs or defenses against the enforcement of any right or remedy of Landlord, or any duty or obligation of Tenant, hereunder (and, if so, specifying the same in detail); (d) that rent is paid currently without any offset or defense thereto; (e) the dates, if any, to which any rent has been paid in advance; (f) whether or not there is then existing any claim of Landlord’s default under this Lease and, if so, specifying the same in detail; 21 (g) that Tenant has no knowledge of any event having occurred that authorized the termination of this Lease by Tenant (or if Tenant has such knowledge, specifying the same in detail); and (h) any other matters relating to the status of this Lease that Landlord or its mortgagee may request be confirmed, provided that such facts are accurate and ascertainable. In the event Tenant refuses to sign an estoppel without a reasonable documented reason that Landlord refuses to cure, this will be treated as an event of default and the lease will be immediately terminated hereunder within 30 days from initial requested notice for Estoppel from the Landlord. ARTICLE XIV [RESERVED] ARTICLE XV DEFAULT AND REMEDIES Section 15.1. Elements of Default. If any one or more of the following events occur, said event or events shall constitute a “default”: (a) Intentionally Deleted; (b) the failure of Tenant to pay any Rent or other charges required to be paid by Tenant when same shall become due and payable hereunder and such failure shall continue for five (5) days after Tenant’s receipt of written notice thereof (provided however, that such notice shall be required to be given, and such cure right shall only be available, to Tenant twice in any twelve (12) month period); (c) the failure of Tenant to perform or observe any term or condition of this Lease (other than as set forth in subparagraphs (a), (b), (d) and (e) of this Section 15.1), if such failure shall continue for thirty (30) days after written notice or, if such failure cannot reasonably be cured within thirty (30) days Tenant fails to commence such cure within such thirty (30) day period and thereafter diligently pursue such cure to completion; (d) if any writ of execution, levy, attachment or other legal process of law shall occur with respect to Tenant’s assets, merchandise or fixtures or Tenant’s estate or interest in the Premises; or (e) if Tenant shall be liquidated or dissolved or shall begin proceedings toward such liquidation or dissolution, or shall in any manner permit the divestiture of all or any substantial part of Tenant’s assets. Section 15.2. Landlord’s Remedies. In the event of any such default or breach by Tenant, at any time thereafter, with or without notice or demand and without limiting Landlord in the exercise of any right or remedy which Landlord may have by reason of such default or breach: (a) Landlord, in addition to other rights or remedies it may have, shall have the right, by written notice to Tenant, to declare this Lease terminated and the Term ended, in which event this Lease and the Term shall terminate with the same force and effect as though the date set forth in the notice of termination was the date originally set forth herein and fixed for the expiration of the then-current Term, and Tenant shall immediately vacate and surrender the Premises in accordance with Section 18.1, but shall remain liable for all obligations arising during the balance of the then-current Term as if this Lease had remained in full force and effect. In the case where Landlord has terminated the Lease, Landlord shall use reasonable efforts to re-lease the Premises to mitigate the damages to Landlord. If Tenant fails to vacate the Premises, Landlord may, without prejudice to any other remedy which it may have for possession or arrearages in rent, enter upon and take possession of the Premises and expel or remove Tenant and any other person who may be occupying the Premises or any part thereof, without being liable for prosecution or any claim or damage therefor; and Landlord may recover from Tenant the following: 22 (i) The worth at the time of award of any unpaid rent which has been earned at the time of such termination; plus (ii) The worth at the time of award of the amount by which the unpaid rent which would have been earned after termination until the time of award exceeds the amount of such rental loss that Tenant proves could have been reasonably avoided; plus (iii) The worth at the time of award of the amount by which the unpaid rent for the balance of the Lease Term after the time of award exceeds the amount of such rental loss that Tenant proves could have been reasonably avoided; plus (iv) Any other amount necessary to compensate Landlord for all the detriment proximately caused by Tenant’s failure to perform its obligations under this Lease or which in the ordinary course of things would be likely to result therefrom, specifically including but not limited to, brokerage commissions and advertising expenses incurred, expenses of remodeling the Premises or any portion thereof for a new tenant, whether for the same or a different use, and any special concessions made to obtain a new tenant; and (v) At Landlord’s election, such other amounts in addition to or in lieu of the foregoing as may be permitted from time to time by applicable law. The term “rent” as used in this Subsection 15.2(a) shall be deemed to be and to mean all sums of every nature required to be paid by Tenant pursuant to the terms of this Lease, whether to Landlord or to others. As used in Subsections 15.2(a)(i) and (ii) above, the “worth at the time of award” shall be computed by allowing interest at the rate specified in Section 21.12 hereof, but in no case greater than the maximum amount of such interest permitted by law. As used in Subsection 15.2(a)(iii) above, the “worth at the time of award” shall be computed by discounting such amount at the discount rate of the Federal Reserve Bank of Atlanta at the time of award plus one percent (1%). (b) Landlord shall have the right to bring a summary proceeding to recover possession from Tenant and/or Landlord may, upon three (3) days’ notice to Tenant, re-enter the Premises and dispossess, by summary proceedings or otherwise, Tenant and the legal representatives of Tenant or other occupant(s) of the Premises and remove their effects, and Tenant shall have no further claim or right hereunder. To the extent permitted by law, Tenant waives notice of re-entry or institution of legal proceedings to that end and any right of redemption, re-entry or repossession. No re-entry or commencement of any action for re-entry shall be construed as an election to terminate this Lease, nor shall it absolve or release Tenant from any of its obligations for the remainder of the Term. In the event of re-entry, Landlord may remove all persons and property from the Premises, and such property may be removed and stored in a public warehouse or elsewhere at the expense and risk of Tenant, without notice or resort to legal process and without Landlord being deemed guilty of trespass or becoming liable for any loss or damage which may be occasioned thereby. (c) Upon any reletting, all rentals and other sums received by Landlord from such reletting shall be applied, first, to the payment of any indebtedness other than rent due hereunder from Tenant to Landlord; second, to the payment of any costs and expenses of such reletting, including reasonable brokerage fees and attorneys’ fees and the costs of any alterations and repairs; third, to the payment of rent and other charges due and unpaid hereunder; and the residue, if any, shall be held by Landlord and applied in payment of future rent as the same may become due and payable hereunder. If such rentals and other sums received from such reletting during any month shall be less than the amount payable to Landlord by Tenant hereunder for the subject month, Tenant shall reimburse Landlord for all costs and expenses of such reletting within thirty (30) days after Landlord’s written request; if such rentals and other sums shall be more, Tenant shall have no right to, and shall receive no credit for, the excess. (d) Any damage or loss of rent sustained by Landlord may be recovered by Landlord, at Landlord’s option, at the time of the reletting or termination, in a single action or in separate actions from time to time as 23 said loss of rents or damages shall accrue, or in a single proceeding deferred by Landlord or with jurisdiction reserved by the court until the expiration of the Term (in which event Tenant hereby agrees that, at Landlord’s option, the cause of action shall not be deemed to have accrued until the date of expiration of the Term). In case suit shall be brought for recovery of the Premises, or for the recovery of rent or any other amount due under the provisions of this Lease, Tenant shall pay to Landlord all expenses incurred therefor, including reasonable attorneys’ fees. (e) Nothing contained herein shall prevent the enforcement of any claim Landlord may have against Tenant for anticipatory breach of the unexpired Term. In the event of an anticipatory breach by Tenant of any of the covenants or provisions hereof or in the event of Tenant’s default, Landlord shall have the right of injunction and the right to invoke any remedy allowed at law or in equity as if re-entry, summary proceedings and other remedies were not provided for herein. Mention in this Lease of any particular remedy shall not preclude Landlord from any other remedy, in law or in equity. Tenant hereby expressly waives for itself and all persons claiming by or through Tenant, any and all rights to redeem, reinstate, restore, or obtain relief from forfeiture of this Lease granted by or under any present or future law in the event of Tenant being evicted or dispossessed for any cause, or in the event of Landlord obtaining possession of the Premises by reason of the violation by Tenant of any of the covenants and conditions of this Lease. Section 15.3. Bankruptcy. (a) Neither Tenant’s interest in this Lease, any guarantor of this Lease, any estate hereby created in Tenant nor any interest herein or therein, shall pass to any trustee or receiver or assignee for the benefit of creditors or otherwise by operation of law, except as may specifically be provided pursuant to the Bankruptcy Code (11 USC §101 et. seq.), as the same may be amended from time to time. (b) It is understood and agreed that this Lease is a lease of real property in an Building as such lease is described in Section 365 of the Bankruptcy Code, as the same may be amended from time to time. Upon the filing of a petition by or against Tenant or any guarantor of this Lease under the Bankruptcy Code, Tenant or any guarantor of this Lease, as debtor and as debtor-in-possession, and any trustee who may be appointed with respect to the assets of or estate in bankruptcy of Tenant or any guarantor of this Lease, agree to pay monthly in advance on the first day of each month, as reasonable compensation for the use and occupancy of the Premises, an amount equal to all Minimum Rent, Additional Rent and other charges otherwise due pursuant to this Lease. Included within and in addition to any other conditions or obligations imposed upon Tenant or its successor in the event of the assumption and/or assignment of this Lease are the following: (1) the cure of any monetary defaults and reimbursement of pecuniary loss within not more than thirty (30) days of assumption and/or assignment; (2) the deposit of a sum equal to not less than three (3) months’ Minimum Rent and Additional Rent, which sum shall be determined by Landlord, in its sole discretion, to be a necessary deposit to secure the future performance under this Lease of Tenant or its assignee; (3) the use of the Premises as set forth in Section 5.1 of this Lease being unchanged; and (4) the prior written consent of any mortgagee to which this Lease has been assigned as collateral security. Section 15.4. Additional Remedies and Waivers. The rights and remedies of Landlord set forth herein shall be in addition to any other right and remedy now or hereafter provided by law or in equity, and all such rights and remedies shall be cumulative (provided that no duplicate recovery of damages shall result therefrom). No action or inaction by Landlord shall constitute a waiver of a default or termination, and no waiver of default or termination shall be effective unless it is in writing signed by Landlord. No waiver by Landlord of any violation or breach of any of the terms, provisions or covenants herein contained shall be deemed or construed to constitute a waiver of any other or later violation or breach of the same or any other of the terms, provisions and covenants herein contained. Section 15.5. Landlord’s Cure of Default. In addition to Landlord’s right of self-help set forth elsewhere in this Lease or as provided by law or in equity, if Tenant shall be in default hereunder beyond applicable cure period, Landlord shall have the option, but not the obligation, upon three (3) days written notice 24 to Tenant (except in the event of any dangerous condition or emergency, in which event no notice shall be required), to cure the act or failure constituting said default for the account of and at the expense of Tenant. Landlord’s cure of, or attempt to cure, any act or failure constituting the default by Tenant shall not result in a waiver or release of Tenant’s obligations under this Lease. Tenant agrees to pay Landlord Interest, in accordance with Section 21.12 below, on all sums expended by Landlord pursuant to this Section 15.5 from the date of such expenditure, and Tenant agrees to pay the costs incurred by Landlord pursuant to this Section 15.5, plus a charge of seven percent (7%) of such costs, to Landlord upon demand, as Additional Rent. Section 15.6. Landlord's Default and Tenant's Remedies. Landlord shall be in default if it fails to perform any term, condition, covenant or obligation required under this Lease for a period of thirty (30) days after written notice thereof from Tenant to Landlord; provided, however, that if the term, condition, covenant or obligation to be performed by Landlord is such that it cannot reasonably be performed within thirty (30) days, such default shall be deemed to have been cured if Landlord substantially and materially commences such performance within said thirty-day period and thereafter diligently undertakes to complete the same as promptly as is commercially reasonable. Upon the occurrence of any such default, Tenant may sue for injunctive relief or to recover damages for any loss directly resulting from the breach, including reasonable attorneys’ fees, but Tenant shall not be entitled to terminate this Lease or withhold, offset or abate any sums due hereunder, except as expressly provided hereunder. In no event, however, shall Landlord be liable for any consequential or punitive damages. No waiver by Tenant of any violation or breach of any of the terms, provisions or covenants herein contained shall be deemed or construed to constitute a waiver of any other or later violation or breach of the same or any other of the terms, provisions and covenants herein contained. ARTICLE XVI RIGHT OF ACCESS Provided that Tenant is able to access the Premises to conduct business during any such activity described below, Landlord, its agents and employees may, upon forty-eight (48) hours prior notice when possible to Tenant (except in the event of an emergency, in which event no notice shall be required), enter upon the Premises for the purpose of: (a) inspecting the same; (b) performing any obligation of Landlord under this Lease; and (c) showing the Premises to prospective purchasers, lenders or lessees (but only in the last twelve (12) months of the Term); and (d) erecting, using, maintain and repairing pipes, conduits, plumbing, vents, ducts and wires in, to, under and through the Premises to the extent that Landlord deems necessary for the proper operation and maintenance of the Building. Landlord agrees to indemnify, defend and hold Tenant harmless from any damage or injury to person or property to the extent resulting from Landlord exercising its rights under this Article XVI. Landlord shall use all commercially reasonable efforts to avoid material interference with the operation of Tenant’s business within the Premises. Except in the event of an emergency, Landlord shall not enter the Premises without an employee of Tenant accompanying Landlord’s representative provided that Tenant makes an employee available following Landlord’s notice to Tenant of the necessity therefor. Provided that Landlord shall pursue any repairs and other obligations as provided above with reasonable diligence, there shall be no abatement in Rent because of any interruption of Tenant’s operations unless such interruption or suspension shall render the Premises substantially untenantable for a period in excess of three (3) consecutive business days, subject, in which event Tenant shall thereafter be entitled to an equitable abatement of Minimum Rent until such time as the Premises are again tenantable. In the event that Landlord and Tenant are unable to agree as to the amount of any such equitable abatement, the same shall be determined by arbitration. ARTICLE XVII DELAYS If Landlord or Tenant is delayed or prevented from performing any of their respective obligations during the Term because of strikes, lockouts, labor troubles, acts of God, natural disasters, inability to procure materials, failure of power, governmental restrictions or reasons of a like nature not the fault of the party delayed in performing such obligation, then the period of such delays shall be deemed added to the time herein provided for the performance of any such obligation, and the defaulting party shall not be liable for losses or damages 25 caused by such delays; provided, however, that this Article shall not apply to the payment of any sums of money required to be paid hereunder or any obligation of Landlord or Tenant that can be satisfied by the payment of money, or affect Tenant’s right to terminate this Lease under Section 4.2 above. ARTICLE XVIII END OF TERM Section 18.1. Return of Premises. Upon the expiration or sooner termination of the Term, Tenant shall surrender to Landlord the Premises in accordance with the terms of this Lease and in a broom-clean condition, in good order, condition and repair, ordinary wear and tear and damage by casualty excepted, and shall surrender to Landlord all keys to the Premises. Tenant shall furnish the landlord with a letter from a certified HVAC contractor stating that either i) all HVAC units are in good working order ii) some or all of the HVAC units are in need of repair and a detailed proposal for such repair or iii) some or all of the HVAC units are beyond their usable life and a proposal for replacement. Subject to the provisions of Section 4.5 above, Tenant, at its expense, shall promptly remove all personal property of Tenant, repair all damage to the Premises caused by such removal and restore the Premises to the condition that existed prior to the installation of the property so removed. Any personal property of Tenant not removed within seven (7) days following the expiration or earlier termination of this Lease shall be deemed to have been abandoned by Tenant and shall, at Landlord’s option, become the property of Landlord, and may be retained or disposed of by Landlord, as Landlord shall desire. Tenant’s obligation to observe or perform the covenants set forth in this Section shall survive the termination of this Lease. Section 18.2. Holding Over. If Tenant shall hold possession of the Premises after the expiration or termination of this Lease, at Landlord’s option (a) Tenant shall be deemed to be occupying the Premises as a tenant from day to day, at one hundred and fifty percent (150%) of the Minimum Rent following the lease expiration, and other charges in effect during the last Lease Year immediately preceding such holdover and otherwise subject to all of the terms, covenants and conditions of this Lease; or (b) Landlord may exercise any other remedies it has under this Lease or at law or in equity including an action for wrongfully holding over. No extension or renewal of this Lease shall be deemed to have occurred by any holding over. ARTICLE XIX COVENANT OF QUIET ENJOYMENT Landlord covenants that, so long as Tenant pays the rent and all other charges and performs all of its obligations provided for herein, Tenant shall at all times during the Term peaceably have, hold and enjoy the Premises, without any interruption or disturbance from Landlord or anyone lawfully or equitably claiming through or under Landlord, subject to the terms hereof. ARTICLE XX [INTENTIONALLY DELETED] ARTICLE XXI MISCELLANEOUS Section 21.1. Entire Agreement. This Lease contains the entire agreement between the parties hereto, and there are no promises, agreements, conditions, undertakings, warranties, or representations, oral or written, express or implied, between them other than as herein set forth. No change or modification of this Lease or of any of the provisions hereof shall be valid or effective unless the same is in writing and signed by the parties hereto. No alleged or contended waiver of any of the provisions of this Lease shall be valid or effective unless in writing signed by the party against whom it is sought to be enforced. 26 Section 21.2. Notices. All notices, requests, demands or other communications hereunder shall be in writing and deemed given (i) when delivered personally, or (ii) on the day deposited in the U.S. Mail, by registered or certified mail, return receipt requested, postage prepaid, (iii) on the day deposited with a recognized overnight courier service (such as Federal Express), or (iv) via electronic mail, in all events addressed as follows (or to such other address which a party may from time to time hereafter designate by notice given in accordance with this Section 21.2): If to Landlord: NSHORE, LLC P.O. Box 357742 Gainesville, Florida 32635 Attention: Taraz N. Darabi with a copy to: Withers Harvey, P.A. 5538 NW 43rd Street, Suite B Gainesville, Florida 32653 Attention: Richard I. Withers or to such other addresses as Landlord shall designate by giving written notice thereof to Tenant. If to Tenant: 400 A1A Beach Blvd ST. AUGUSTINE, FL 32080 Attn: Amanda and Michael Iannella, Matthew L. Conner and Harold V. Groome Email. amanda.iannella@yahoo.com, matt@mlconnerconstruction.com, laceyjconner@gmail.com or to such other addresses as Tenant shall designate by giving written notice thereof to Landlord. The time to reply to any such notice, request, demand or other communication shall commence upon actual or deemed delivery, however. Refusal to accept delivery by any party or the inability to deliver any communication because of a changed address of which no notice has been given in accordance with this Section 21.2 shall constitute delivery. Notices may be given by a party’s attorney or other authorized representative. Section 21.3. Governing Law. It is the intent of the parties hereto that all questions with respect to the construction of this Lease and the rights and the liabilities of the parties hereto shall be determined in accordance with the laws of the State of Florida, and that all disputes arising hereunder shall be heard and decided in the local jurisdiction where the Landlord’s office is located. Section 21.4. Successors. This Lease and all rights and liabilities herein given to, or imposed upon, the respective parties hereto shall extend to and bind the several respective heirs, executors, administrators, successors, and assigns of the said parties; and if there shall be more than one Tenant, or more than one person or entity acting collectively as Tenant, they shall all be bound jointly and severally by the terms, covenants and agreements contained herein. Any restriction on or requirement imposed upon Tenant hereunder shall be deemed to extend to Tenant’s guarantor, Tenant’s subleases, Tenant’s assignees and Tenant’s invitees, and it shall be Tenant’s obligation to cause the foregoing persons to comply with such restrictions or requirements. No rights, however, shall inure to the benefit of any assignee or other transferee of Tenant, and no rights or benefits shall be conferred upon any such assignee or transferee by reason of this Section 21.4, unless such rights or benefits shall be expressly otherwise set forth in this Lease. Section 21.5. Brokers. Each party represents and warrants that it has caused or incurred no claims for brokerage commissions or finder’s fees in connection with the execution of this Lease payable to any party, except as prior mentioned. Each party shall indemnify and hold the other harmless against and from all liabilities 27 arising from any such claims caused or incurred by it (including without limitation, the cost of attorneys’ fees in connection therewith) other than fees payable to Brokers, which shall be paid by Landlord pursuant to a separate agreement between Brokers and Landlord. Section 21.6. Transfer by Landlord. Landlord hereunder shall have the right to freely assign this Lease without the consent of Tenant, but with commercially reasonable notice. Section 21.7. No Partnership. Notwithstanding anything to the contrary contained in this Lease, Landlord shall not be deemed to be a partner of Tenant or a joint venture with Tenant. Section 21.8. Waiver of Counterclaims. TENANT SHALL NOT IMPOSE ANY NON- COMPULSORY COUNTERCLAIM OR COUNTERCLAIMS IN A SUMMARY PROCEEDING OR OTHER ACTION BASED ON TERMINATION OR HOLDOVER, IT BEING THE INTENT OF THE PARTIES HERETO THAT TENANT BE STRICTLY LIMITED IN SUCH INSTANCE TO BRINGING A SEPARATE ACTION IN THE COURT OF APPROPRIATE JURISDICTION. THE FOREGOING WAIVER IS A MATERIAL INDUCEMENT TO LANDLORD MAKING, EXECUTING AND DELIVERING THIS LEASE, AND TENANT’S WAIVER OF ITS RIGHT TO COUNTERCLAIM IN ANY SUMMARY PROCEEDING OR OTHER ACTION BASED ON TERMINATION OR HOLDOVER IS DONE KNOWINGLY, INTELLIGENTLY AND VOLUNTARILY. Section 21.9. Waiver of Jury Trial. LANDLORD AND TENANT HEREBY WAIVE TRIAL BY JURY IN ANY ACTION, PROCEEDING OR COUNTERCLAIM BROUGHT BY EITHER OF THE PARTIES HERETO AGAINST THE OTHER ON, OR IN RESPECT OF, ANY MATTER WHATSOEVER ARISING OUT OF OR IN ANY WAY CONNECTED WITH THIS LEASE, THE RELATIONSHIP OF LANDLORD AND TENANT HEREUNDER, TENANT’S USE OR OCCUPANCY OF THE PREMISES AND/OR ANY CLAIM OF INJURY OR DAMAGE. Section 21.10. Severability. If any term or provision of this Lease, or the application thereof to any person or circumstances, shall, to any extent, be invalid or unenforceable, the remainder of this Lease, or the application of such term or provision to persons or circumstances other than those as to which it is invalid or unenforceable, shall not be affected thereby, and each term and provision of this Lease shall be valid and shall be enforced to the fullest extent permitted by law. Section 21.11. No Waiver. No failure by Landlord to insist upon the strict performance of any term, covenant, agreement, provision, condition or limitation of this Lease to be kept, observed or performed by Tenant, and no failure by Landlord to exercise any right or remedy available upon a breach of any such term, covenant, agreement, provision, condition or limitation of this Lease, shall constitute a waiver of any such breach or of any such term, covenant, agreement, provision, condition or limitation of this Lease. Section 21.12. Interest. Any amount due from Tenant to Landlord which is not paid when due shall bear Interest from the date due until paid, unless otherwise specifically provided herein, but the payment of such Interest shall not excuse or cure any default by Tenant under this Lease. In no event shall any Interest calculated under this Lease be at a rate which is higher than the maximum rate which is allowed under the usury laws of the State, which maximum rate of interest shall be substituted for the rate in excess thereof, if any, computed pursuant to this provision. Section 21.13. Rules and Regulations. Tenant agrees to comply with the Rules and Regulations attached hereto as Exhibit B and observe all other reasonable and non-discriminatory rules and regulations established by Landlord from time to time. Tenant’s failure to keep and observe such rules and regulations shall constitute a default under this Lease. Landlord shall, to the extent commercially reasonable and practicable, apply the Rules and Regulations uniformly. In the event of a disagreement between the Rules and Regulations and this Lease, the terms of this Lease shall control. 28 Section 21.14. Intentionally Deleted. Section 21.15. General Rules of Construction. (a) This Lease may be executed in several counterparts, and the counterparts shall constitute one and the same instrument; (b) Landlord may act under this Lease by its attorney or agent; (c) wherever a requirement is imposed on Tenant hereunder, Tenant shall be required to perform such requirement at its sole cost and expense unless it is specifically otherwise provided herein; (d) (i) wherever appropriate herein, the singular includes the plural and the plural includes the singular; (ii) whenever the word “including” is used herein without further explanation, it shall be deemed to mean “including, without limitation”; and (iii) the words “re-enter” and “re-entry” as used herein shall not be restricted to their technical legal meaning; (e) anything in this Lease to the contrary notwithstanding: (i) any provision hereof which permits or requires a party to take any particular action shall be deemed to permit or require, as the case may be, such party to cause such action to be taken; and (ii) any provision hereof which requires any party not to take any particular action shall be deemed to require such party to prevent such action to be taken by any person or by operation of law. Section 21.16. Recording. Neither this Lease nor any memorandum hereof may be recorded without the express written consent of Landlord. Section 21.17. Effective Date. For all purposes hereof, the “Effective Date” of this Lease shall be the date upon which this Lease shall have been executed by both parties and delivered by Landlord to Tenant or its attorney, which date shall be inserted in the introductory paragraph on page 1 of this Lease. Prior to the Effective Date, neither this Lease nor anything hereunder contained shall be legally binding on either Landlord or Tenant, and the submission of this Lease by Landlord to Tenant prior to such Effective Date for examination or consideration by Tenant or discussion between Landlord and Tenant shall not constitute a reservation of or option for the Premises or create any legal obligation or liability whatsoever on Landlord. Section 21.18. Headings. The captions, section numbers, article numbers and index appearing in this Lease are inserted only as a matter of convenience and in no way define, limit, construe, or describe the scope or intent of such sections or articles of this Lease nor in any way affect this Lease. Section 21.19. Tenant Liability. If two or more individuals, corporations, partnerships or other persons (or any combination of two or more thereof) shall sign this Lease as Tenant, the liability of each such individual, corporation, partnership or other persons to pay rent and perform all other obligations hereunder shall be deemed to be joint and several, and all notices, payments and agreements given or made by, with or to any one of such individuals, corporations, partnerships or other persons shall be deemed to have been given or made by, with or to all of them. Section 21.20. Other Tenants. Except as specifically set forth herein, Landlord reserves the absolute right to effect tenancies in the Project and the Building as Landlord shall determine in the exercise of its sole business judgment. Section 21.21. Due Authorization. If a party is a corporation, a limited liability company or a partnership, the person(s) executing this Lease on behalf of said party hereby covenants and warrants that: said party is a duly formed corporation or a duly formed limited liability company or a duly created partnership (as the case may be) in good standing, qualified to do business in the state in which the Building are located; such persons are duly authorized by such corporation or limited liability company or partnership to execute and deliver this Lease on behalf of such corporation, limited liability company or partnership; and this Lease constitutes a valid and binding agreement of such party in accordance with the terms hereof. In connection with this Section 21.21, each party agrees to execute and deliver to the other party upon written request, authorizing resolutions or written consent authorizing the party entering enter into this Lease and any amendments or modifications of the Lease. 29 Section 21.22. Confidentiality. It is agreed and understood that Landlord and Tenant may acknowledge only the existence of this Lease by and between Landlord and Tenant, the square feet of and the location of the Premises, and that neither party may disclose any of the terms and provisions contained in this Lease to any other party, including tenant or occupant in the Building or to any agent, employee, subtenant or assignee of such tenant or occupant. Notwithstanding the foregoing, either party may disclose the confidential information if required by law or court order, and to its brokers, attorneys, accountants, consultants, employees, existing or prospective financial partners or investors, prospective purchasers of the Project or of Landlord or Tenant, and prospective assignees and subtenants, provided same are advised of the confidential nature of the information and each agrees to maintain the confidentiality thereof prior to disclosure. Tenant acknowledges that any breach by Tenant of the agreements set forth in this Section 21.22 shall cause Landlord irreparable harm. The terms and provisions of this Section 21.22 shall survive the termination of this Lease (whether by lapse of time or otherwise). Section 21.23. Attorneys’ Fees. If any Rent is collected by or through an attorney at law retained for the special purpose of collecting past-due Rent, or if either party institutes any legal action against the other party and retains an attorney at law to prosecute such action in connection with enforcement of any covenant or obligation by the ther party or of any right or remedy of a party hereunder, then the non-prevailing party agrees to pay the reasonable attorney’s fees incurred by the prevailing party and all court costs and all costs of collection, including but not limited to costs of depositions and expert witnesses. Section 21.24. Waiver of Redemption by Tenant. TENANT HEREBY WAIVES FOR TENANT AND FOR ALL THOSE CLAIMING UNDER TENANT ALL RIGHT NOW OR HEREAFTER EXISTING TO REDEEM BY ORDER OR JUDGMENT OF ANY COURT OR BY ANY LEGAL PROCESS OR WRIT, TENANT’S RIGHT OF OCCUPANCY OF THE PREMISES AFTER ANY TERMINATION OF THIS LEASE. Section 21.25. Non-Discrimination. Tenant herein covenants by and for itself, its successors and assigns, and all persons claiming under or through them, and this Lease is made and accepted upon and subject to the following conditions: That there shall be no discrimination against or segregation of any person or group of persons, on account of race, color, religion, creed, national origin, ancestry, handicap, age, marital status, or sex in the leasing, subleasing, renting, transferring, use, occupancy, tenure or enjoyment of the Premises, nor shall Tenant for itself, or for any person claiming under or through it, establish or permit such practice or practices of discrimination or segregation with reference to the selection, location, number or occupancy of tenants, leases, subleases, subtenants, or vendors in the Premises. Section 21.26. Relocation of Tenant. Landlord shall have the right, at any time upon thirty (30) days notice to Tenant, to relocate Tenant into other space within the Shopping Center. Upon such relocation, such new space shall be deemed the Demised Premises and the prior space originally demised shall in all respects be released from the effect of this Lease. If the Landlord elects to relocate the Tenant as above described, (i) the new Demised Premises shall contain approximately the same usable area than the original Demised Premises within five percent (5%) +/-, (ii) the Landlord shall improve the new Demised Premises, at Landlord’s sole cost, substantially similar to the standards of the original Demised Premises, (iii) the Landlord shall pay the reasonable costs of moving Tenant’s trade fixtures and furnishing from the original Demised Premises to the new Demised Premises, (iv) as total compensation for all other costs, expenses and damages which Tenant may suffer in connection with the relocation, including but not limited to, lost profit or business interruption, no Minimum Rent shall be due or payable for the first full calendar month of Tenant’s occupancy of the new Demised Premises, and Landlord shall not be liable for any further indirect or special expenses of Tenant resulting from the relocation, (v) Minimum Rent, Tenant’s proportionate share of Operating Expenses, and all other charges hereunder shall be adjusted for variation in the square footage of the new Demised Premises, and (vi) all other terms of this Lease shall apply to the new Demised Premises, except as otherwise provided in this paragraph. Tenant shall cooperate with Landlord, in all reasonable ways, to facilitate the relocation and building of the new Demised Premises in a cost effective manner, and permit the necessary action to make changes. If Landlord cannot provide similar-sized space within the Shopping Center, or if Tenant fails to fully cooperate with 30 Landlord, Landlord shall have the right to terminate this lease as of the date that is sixty (60) days after delivery of notice of termination to Tenant. From and after the date of such a termination, neither Landlord nor Tenant will have any obligations under the Lease, except those obligations that, by their nature or pursuant to the terms of the Lease, would otherwise survive beyond the expiration of termination of the Lease. Section 21.27. Telecommunications Equipment/Early Access. Tenant shall be entitled to install its telecommunications cabling, electrical wiring and related equipment subject to Landlord’s advance written approval, which shall not be unreasonably withheld, conditioned or delayed. Tenant shall remove such cabling, wiring and equipment upon the expiration or earlier termination of this Lease in accordance with Section 18.1 herein. Notwithstanding the foregoing, in the four (4) week period of time prior to the anticipated substantial completion of Landlord’s Work and delivery of the Premises to Tenant, Tenant shall be permitted to enter the Premises other than to occupy the same for the purposes of measuring, installing cabling and otherwise preparing the Premises for the occupancy of the Premises by Tenant, and while Tenant is on the Premises, Tenant shall comply with all terms and provisions of this Lease, except those provisions requiring the payment of Rent. Section 21.28 Landlord’s Right to Interrupt Utilities . When necessary by reason of accident or other cause occurring in the Premises or elsewhere in the Project, or in order to make any repairs or alterations or additions or improvements in or relating to the Premises or to other portions of the Project, Landlord reserves the right to enter the Premises, to interrupt the supply to the Premises or to the Common Areas, of steam, electricity, water, gas, and other utilities, if any, and also to suspend the operation of the heating or air- conditioning systems in or to the Premises or any other portion of the Project, until said repairs, alterations, additions or improvements shall have been completed. Provided that Landlord shall pursue such work with reasonable diligence, there shall be no abatement in Rent because of any such interruption or suspension unless such interruption or suspension shall render the Premises substantially untenantable for a period in excess of three (3) consecutive business days in which event Tenant shall thereafter be entitled to an equitable abatement of Minimum Rent until such time as the Premises are again tenantable. In the event Landlord and Tenant are unable to agree as to the amount of any such equitable abatement, the same shall be determined by arbitration. In the event that such interruption or suspension shall render the Premises substantially untenantable for a continuous period in excess of thirty (30) days, Tenant shall be permitted to terminate this Lease effective immediately upon written notice to Landlord; provided, however, that in the event Landlord cures the interruption or suspension on or before the receipt of Tenant’s termination notice, such termination notice shall be negated and the terms and conditions of this Lease shall continue in full force and effect. If Tenant elects to terminate this Lease, then this Lease shall be null and void and of no further force or effect, and Landlord shall return to Tenant any prepaid rent and/or Security Deposit hereunder. Section 21.29. Liability of Landlord. NEITHER LANDLORD, ANY PERSONS OR ENTITIES COMPRISING LANDLORD, NOR ANY SUCCESSOR-IN-INTEREST TO LANDLORD (OR TO SUCH PERSONS OR ENTITIES) SHALL HAVE ANY PERSONAL LIABILITY FOR ANY FAILURE BY LANDLORD TO PERFORM ANY TERM, COVENANT OR CONDITION OF THIS LEASE. IF LANDLORD SHALL FAIL TO PERFORM ANY COVENANT, TERM OR CONDITION OF THIS LEASE UPON LANDLORD’S PART TO BE PERFORMED, AND IF AS A CONSEQUENCE OF SUCH DEFAULT TENANT SHALL RECOVER A MONEY JUDGMENT AGAINST LANDLORD, SUCH JUDGMENT SHALL BE SATISFIED ONLY OUT OF THE PROCEEDS OF SALE RECEIVED UPON EXECUTION OF SUCH JUDGMENT AND LEVIED THEREON AGAINST THE RIGHT, TITLE AND INTEREST OF LANDLORD IN THE BUILDING AND OUT OF RENTS OR OTHER INCOME FROM SUCH PROPERTY RECEIVABLE BY LANDLORD, OR OUT OF THE CONSIDERATION RECEIVED BY LANDLORD FROM THE SALE OR OTHER DISPOSITION OF ALL OR ANY PART OF LANDLORD’S RIGHT, TITLE AND INTEREST IN THE BUILDING, SUBJECT, NEVERTHELESS, TO THE RIGHTS OF LANDLORD’S MORTGAGEE, AND NEITHER LANDLORD NOR ANY OF THE PERSONS OR ENTITIES COMPRISING LANDLORD SHALL BE LIABLE FOR ANY DEFICIENCY. THE FOREGOING LIMITATION OF LIABILITY SHALL BE NOTED IN ANY JUDGMENT SECURED AGAINST LANDLORD. THE LIMITATIONS OF TENANT’S RIGHT OF RECOVERY AGAINST LANDLORD AND ANY LANDLORD RELATED 31 PARTIES SET FORTH IN THIS SECTION 21.29 SHALL SURVIVE THE EXPIRATION OF THE TERM (WHETHER BY LAPSE OF TIME OR OTHERWISE). Section 21.30. Radon Gas. Radon is a naturally occurring radioactive gas that, when it has accumulated in a building in sufficient quantities, may present health risks to persons who are exposed to it over time. Levels of radon that exceed federal and state guidelines have been found in Building in Florida. Additional information regarding radon and radon testing may be obtained from your county public health unit. Section 21.31. Non-Responsibility for Certain Liens. Pursuant to Section 713.10, Florida Statutes, as same may be amended or replaced from time to time, Landlord’s interest as herein described shall not be subject to liens for improvements made by Tenant or any subtenant, and upon request of Landlord, Tenant shall join in a Notice of Non-Responsibility attesting to such fact. Section 21.32. Landlord Representations. Landlord hereby represents and warrants to Tenant that, as of the Effective Date: (a) Landlord is the sole owner of the Building, and owns a fee simple interest therein; (b) to the best of Landlord’s knowledge, the Building, the property on which the Building is located and the Premises are free of any hazardous or toxic materials; (c) there is no action, suit or proceeding pending or, to the best of Landlord’s knowledge, with no duty of inquiry, threatened against or affecting the Building, or arising out of the ownership, management or operation of the Building, which could impair Landlord’s ability to observe the terms and conditions of this Lease. Landlord hereby agrees to indemnity, defend and hold Tenant harmless with respect to the foregoing. Section 21.33. Outdoor Seating.. Provided Tenant is at all times in compliance with any government and municipal laws and regulations, Landlord consents to Tenant’s use of the sidewalk area immediately outside Tenant’s storefront to place tables and chairs exclusively for Tenant’s customers. Tenant shall be responsible for maintaining any tables and chairs in a 1st-class manner and shall remove them from the side walk outside of Tenant’s hours of operation. [SIGNATURES COMMENCE ON FOLLOWING PAGE] 34 GUARANTY OF LEASE This GUARANTY OF LEASE (“Guaranty”) is attached to and made a part of that certain Lease Agreement dated _______________, 20__ (“Lease”), between NSHORE, LLC, or its successor(s), assignee(s) and/or designee(s) (“Landlord”) and ROSQUILLAS 2, LLC, a Florida limited liability company, (“Tenant”), covering the certain premises (“Premises”) in the shopping center project known as The Shoppes of Northshore, located in Atlantic Beach, Florida. The terms used in this Guaranty shall have the same definitions as set forth in the Lease. The provisions of this Guaranty shall supersede any inconsistent or conflicting provisions of the Lease. 1. Guaranty. As an essential inducement to the granting of the Lease from Landlord to Tenant, and its successors and assigns the undersigned (“Guarantor”) hereby guarantees unconditionally to Landlord the timely payment and performance of all rent, charges, and obligations of Tenant under the Lease (as such terms are defined under the Lease) and all other documents evidencing or securing the obligations under such Lease, including, without limitation, the obligation to pay all Basic Rental and additional rental, and all taxes and other charges levied under the Lease and all maintenance and indemnity obligations thereunder (collectively, the “Guaranteed Obligations”). Guarantor acknowledges, covenants and agrees that this Guaranty shall survive the termination of the Lease and shall continue in full force and effect with respect to any of Tenant’s obligations under the Lease which are not performed upon and which survive the termination of the Lease. 2. Rights of Landlord. Guarantor authorizes Landlord to take and hold any security for the Guaranteed Obligations, and to accept additional or substituted security, to subordinate, compromise or release any security, to release Tenant of its liability for all or any part of the Guaranteed Obligations, to participate in any settlement offered by Tenant or any guarantor, whether in liquidation, reorganization, receivership, bankruptcy or otherwise, to release, substitute or add any one or more guarantors or endorses, and to assign this Guaranty in whole or in part. Landlord may take any of the foregoing actions upon any terms and conditions as Landlord may elect, without giving notice to Guarantor or obtaining the consent of Guarantor and without affecting the liability of Guarantor to Landlord. 3. Independent Obligations. Guarantor’s obligations under this Guaranty are independent of those of Tenant or of any other guarantor. Landlord may bring a separate action against Guarantor without first proceeding against Tenant or any other person or any security held by Landlord and without pursuing any other remedy. Landlord’s rights under this Guaranty shall not be exhausted by any action of Landlord until all of the Guaranteed Obligations have been fully performed. 4. Waiver of Defenses. Guarantor waives: a. any right to require Landlord to proceed against Tenant or any other person or any security now or hereafter held by Landlord or to pursue any other remedy whatsoever; b. any defense based upon any legal disability of Tenant or any guarantor, or any discharge or limitation of the liability of Tenant or any guarantor to Landlord, or any restraint or stay applicable to actions against Tenant or any other guarantor, whether such disability, discharge, limitation, restraint or stay is consensual, or by order of a court or other governmental authority, or arising by operation of law or any liquidation, reorganization, receivership, bankruptcy, insolvency or debtor-relief proceeding, or from any other cause; c. presentment, demand, protest or notice of any kind; d. any defense based upon the modification, renewal, extension or other alteration of the Guaranteed Obligations agreed to by Tenant, or of the documents executed in connection therewith; 35 e. any defense based upon the negligence of Landlord, including, without limitation, the failure to record an interest under a lease, sublease, or deed of trust, the failure to perfect any security interest, or the failure to file a claim in any bankruptcy of the Tenant or any guarantor; f. any defense based upon a statute of limitations to the fullest extent permitted by law and any defense based upon Landlord’s delay in enforcing this Guaranty; g. all rights of subrogation, reimbursement, indemnity, all rights to enforce any remedy that Landlord may have against Tenant, and all rights to participate in any security held by Landlord for the Guaranteed Obligations, until the Guaranteed Obligations have been performed in full, and any defense based upon the impairment of any subrogation, reimbursement or indemnity rights that Guarantor might have; h. any defense based upon or arising out of any defense which Tenant may have to the performance of any part of the Guaranteed Obligations, other than the defense of prior material breach by Landlord of any of its dependent covenants thereto; i. any defense based upon the death, incapacity, lack of authority or termination of existence or revocation hereof by any person or entity or persons or entities, or the substitution of any party hereto; j. any defense to recovery by Landlord of a deficiency after non-judicial sale of real or personal property, any defense based upon the unavailability to Landlord of recovery of a deficiency judgment after non-judicial sale of real or personal property, and any defense based upon any applicable law; k. any defense based upon or related to Guarantor’s lack of knowledge as to Tenant’s financial condition; l. any and all rights to revoke this Guaranty in whole or in part. 5. Tenant’s Financial Condition. Guarantor is relying upon its own knowledge and is fully informed with respect to Tenant’s financial condition. Guarantor assumes full responsibility for keeping fully informed of the financial condition of Tenant and all other circumstances affecting Tenant’s ability to perform its obligations to Landlord, and agrees that Landlord will have no duty to report to Guarantor any information which Landlord receives about Tenant’s financial condition or any circumstances bearing on Tenant’s ability to perform. 6. Impairment of Subrogation Rights. Upon a default of Tenant, Landlord may elect to foreclose non-judicially or judicially against any real or personal property security it holds for the Guaranteed Obligations or any part thereof, or exercise any other remedy against Tenant or any security. No such action by Landlord will release or limit the liability of Guarantor, even if the effect of that action is to deprive Guarantor of the right or ability to collect reimbursement from or assert subrogation, indemnity or contribution rights against Tenant or any other guarantor for any sums paid to Landlord, or to obtain reimbursement by means of any security held by Landlord for the guaranteed obligations. 7. Default. Each of the following shall constitute a default of Guarantor under this Guaranty: a. the failure of Guarantor to perform any of its obligations under this Guaranty; b. the commencement of any bankruptcy, insolvency, arrangement, reorganization, or other debtor-relief proceeding under any federal or state law by Tenant or Guarantor, whether now existing or hereafter enacted; or 36 c. the occurrence of a default by Tenant under the Lease or the failure of any representation or warranty contained herein or in the Lease to be accurate and complete. Upon an occurrence of a default under this Guaranty as specified above, Landlord may, at its option, without notice or demand upon Guarantor or Tenant, declare the Guaranteed Obligations (or such portion thereof as may be designated by Landlord) immediately due and payable by Guarantor to Landlord. 8. Costs and Expenses. Guarantor agrees to pay Landlord’s reasonable out-of-pocket costs and expenses, including but not limited to legal fees and disbursements, incurred in any effort to collect or enforce any of the Guaranteed Obligations or this Guaranty, whether or not any lawsuit is filed, and in the representation of Landlord in any insolvency, bankruptcy, reorganization or similar proceeding relating to Tenant or Guarantor. Until paid to Landlord, such sums will bear interest from the date such costs and expenses are incurred at the rate set forth in the Lease for past due obligations. 9. Reinstatement. The liability of Guarantor hereunder shall be reinstated and revived, and the rights of Landlord shall continue, with respect to any amount at any time paid on account of the Guaranteed Obligations which Landlord shall thereafter be required to restore or return in connection with the bankruptcy, insolvency or reorganization of Tenant or otherwise, all as though such amount had not been paid. 10. Subordination. Any indebtedness of Tenant to Guarantor now or hereafter existing shall be, and such indebtedness hereby is, deferred, postponed and subordinated to payment and performance of the Guaranteed Obligations. Any payment made to Guarantor by Tenant or any third party with respect to the indebtedness subordinated hereunder while any Guaranteed Obligations remain outstanding shall be held in trust by Guarantor for the benefit of Landlord and shall be turned over to Landlord immediately upon receipt thereof. Any lien, charge or claim which Guarantor now has or hereafter may have on or to any real or personal property of Tenant, including without limitation, any real property subject of the Lease, the personal property located thereon, any rights therein and related thereto, and the revenue and/or income realized therefrom, and security for any loans, advances or other indebtedness of Tenant to Guarantor shall be, and any such lien, claim or charge hereby is, subordinated to the payment and performance of the Guaranteed Obligations. 11. Representations and Warranties. Guarantor, and each of them individually, makes the following representations and warranties, which shall be deemed to be continuing representations and warranties until payment and performance in full of the Guaranteed Obligations: a. Guarantor has all the requisite power and authority to execute, deliver and be legally bound by this Guaranty on the terms and conditions herein stated; b. Guarantor has all the requisite power and authority to transact any other business with Landlord as necessary to fulfill the terms of this Guaranty; c. This Guaranty constitutes the legal, valid and binding obligations of Guarantor enforceable against Guarantor in accordance with its terms; d. Neither the execution and delivery of this Guaranty nor the consummation of the transaction contemplated hereby will, with or without notice and/or lapse of time, constitute a breach of any of the terms and provisions of any note, contract, document, agreement or undertaking, whether written or oral, to which Guarantor is a party or to which Guarantor’s property is subject, accelerate or constitute any event entitling the holder of any indebtedness of Guarantor to accelerate the maturity of any such indebtedness, conflict with or result in a breach of any writ, order, injunction or decree against Guarantor of any court or governmental agency or instrumentality, or conflict with or be prohibited by any federal, state, local or other governmental law, statute, rule or regulation; 37 e. No consent of any other person not heretofore obtained and no consent, approval or authorization of any person or entity is required in connection with the valid execution, delivery or performance by Guarantor of this Guaranty; and f. Neither this Guaranty nor any other statement furnished by Guarantor to Landlord in connection with the transactions contemplated hereby contains any untrue statement of material fact or omits to state a material fact necessary in order to make the statements contained herein or therein true and not misleading. 12. Joint and Several Liability. The obligations, promises, representations and warranties set forth herein shall be the joint and several undertakings of each of the persons executing this Guaranty as a Guarantor. Landlord may proceed hereunder against any one or more of said persons without waiving its rights to proceed against any of the others. 13. Inducement. Guarantor acknowledges that the undertaking given hereunder is given in consideration of Landlord’s entering into the Lease and that Landlord would not consummate the Lease but for the execution and delivery of this Guaranty. 14. Waiver of Jury Trial; Submission to Jurisdiction. As a further inducement to Landlord to enter into the Lease and as additional consideration to Landlord therefor, Guarantor hereby agrees (and by accepting this Guaranty, Landlord shall be deemed to have agreed) that in any action or proceeding brought by either Landlord or the Guarantor against the other on any matters whatsoever arising out of, under, or by virtue of the terms of the within Lease or of this Guaranty, that Landlord and Guarantor shall and do hereby [i] waive trial by jury and [ii] submit to the jurisdiction of the Circuit Court in and for Alachua County, Florida, 15. Miscellaneous. No provision of this Guaranty or Landlord’s rights hereunder may be waived or modified nor can Guarantor be released from its obligations hereunder except by a writing executed by Landlord. No such waiver shall be applicable except in the specific instance for which given. No delay or failure by Landlord to exercise any right or remedy against Tenant or Guarantor will be construed as a waiver of that right or remedy. All remedies of Landlord against Tenant and Guarantor are cumulative. The invalidity or unenforceability of any one or more provisions of this Guaranty will not affect the validity or enforceability of any other provision. This Guaranty shall be governed by and construed under the laws of the State of Florida. The provisions of this Guaranty will bind and benefit the heirs, executors, administrators, legal representatives, successors and assigns of Guarantor and Landlord. The term “Tenant” will mean both the named Tenant and any other person or entity at any time assuming or otherwise becoming primarily liable for all or any part of the Guaranteed Obligations. The term “Landlord” will mean both the Landlord named herein and any future owner or holder of the Lease, or any interest therein. This Guaranty constitutes the entire agreement between Guarantor and Landlord with respect to its subject matter, and supersedes all prior or contemporaneous agreements, representations and understandings. All headings in this Guaranty are for convenience only and shall be disregarded in construing the substantive provisions of this Guaranty. [SIGNATURES ON FOLLOWING PAGE.] EXHIBIT A – Page 1 EXHIBIT A SURVEY EXHIBIT B – Page 1 EXHIBIT B RULES AND REGULATIONS Tenant expressly covenants and agrees, at all times during the Term, and at such other times as Tenant occupies the Premises or any part thereof, to comply, at its own cost and expense, with the following: Landlord shall enforce all rules and regulations in a non-discriminatory manner among all tenants within the Building. 1. The sidewalks, halls, passages, exits, entrances, elevators, and stairways of the Building shall not be obstructed by any of the tenants or used by them for any purpose other than for ingress to and egress from their respective premises. The halls, passages, exits, entrances, elevators, and stairways are not for the general public, and Landlord shall in all cases retain the right to control and prevent access thereto of all persons whose presence in the judgment of Landlord would be prejudicial to the safety, character, reputation and interests of the Building and its tenants, provided that nothing herein contained shall be construed to prevent such access to persons with whom any tenant normally deals in the ordinary course of its business, unless such persons are engaged in illegal activities. No tenant and no employee or invitee of any tenant shall go upon the roof of the Building except such roof or portion thereof as may be contiguous to the Premises of a particular tenant and may be designated in writing by Landlord as a roof deck or roof garden area. 2. No hand trucks, construction personnel, or construction equipment shall be permitted in the Building or carried through the Building entrances and exits except between the hours of 6:15 pm and 7:45 am. The persons employed to move equipment in or out of the Building must be acceptable to Landlord. Landlord shall have the right to prescribe the weight, size and position of all equipment, materials, furniture or other property brought into the Building and the hours of delivery. Heavy objects shall, if considered necessary by Landlord, stand on wood strips of such thickness as is necessary to properly distribute the weight and only during the hours listed above. Landlord will not be responsible for loss of or damage to any such property from any cause and all damage done to the Building by moving or maintaining such property shall be repaired at the expense of Tenant. 3. Tenant shall not (i) suffer, allow or permit any vibration, noise, odor or flashing or bright light to emanate from the Premises or from any machine or other installation located therein, or otherwise suffer, allow or permit the same to constitute a nuisance to or interfere with the safety, comfort or convenience of Landlord or of any other occupant or user of the Building; (ii) display, paint, or place any handbills, bumper stickers or other advertising devices on any vehicle(s) parked in the parking area(s) of the Project or the parking deck, whether belonging to Tenant, its employee(s), or any other person(s); (iii) solicit business or distribute any handbills or other advertising materials in the common areas of the Project; (iv) conduct or permit any activities on or about the Building that constitute a public or private nuisance; (v) permit the parking of any vehicles or the placement of any displays, trash receptacles or other items, so as to interfere with the use of any driveway, fire lane, corridor, walkway, parking area, mall or any other common areas of the Project; (vi) use or occupy the Premises or permit anything to be done therein which in any manner might cause injury or damage in or about the Project; or (vii) use or occupy the Premises in any manner which is unreasonably annoying to other tenants in the Project unless directly occasioned by the proper conduct of Tenant's business in the Premises. 4. Tenant shall secure and protect the Premises, and all property located within the Premises. Tenant acknowledges and agrees that it, and not Landlord, is solely responsible for securing and protecting the Premises, and all property located within the Premises. 5. Tenant shall use the plumbing within the Premises and the Building only for the purpose for which it is designed. Tenant shall be solely responsible for any breakage, stoppage or damage resulting from its violation of this provision, and shall pay any costs associated therewith to Landlord upon demand as Additional Rent. EXHIBIT B – Page 2 6. Smoking is prohibited in all areas of the Project except where expressly permitted by Landlord, if any. Landlord reserves the right to relocate or eliminate any such areas where smoking is permitted, at any time. Smoking within and immediately outside the Building is strictly prohibited. 7. If Tenant undertakes any construction activities which cause any work stoppage, picketing, labor disruption or dispute, so as to interfere with activities at the Project or Building, Tenant shall, upon request from Landlord, immediately suspend any construction work being performed in the Premises giving rise to such labor problems. Tenant shall have no claim for damages of any nature against Landlord for such suspension nor shall the Commencement Date be extended as a result thereof. 8. Tenant shall promptly obtain all permits, including occupancy permits, for the Premises or its use thereof. Tenant shall pay before delinquency all license and permit fees, and other charges of a similar nature, for the conduct of any business in, or any use of, the Premises. Upon request Tenant shall provide to Landlord a copy of all its permits, including the certificate of occupancy. 9. Tenant shall not place a load on any floor in the Building which exceeds the load which the floor was designed to carry, or which may result in improper weight distribution on such floors. 10. Tenant shall not install, operate or maintain in the Premises, or in any other area of the Building, electrical equipment which does not bear the Underwriters Laboratories seal of approval, or which would overload the electrical system or any part thereof beyond its capacity for proper, efficient and safe operation. 11. Except for those items commonly used in Tenant’s Permitted Use (such as cleaning, food preparation or office supplies), Tenant shall not store, display, sell, or distribute any alcoholic beverages, dangerous materials, flammable materials, explosives, or weapons in the Premises, or conduct any unsafe activities therein, unless permitted pursuant to the Permitted Use, but may offer alcoholic beverages at employee social events and client events. 12. No radio or television aerial, HVAC unit or other equipment or device may be erected by Tenant on the roof or on any exterior wall of the Premises, or the Building in which the Premises is located, without Landlord's prior written consent. Any aerial or other equipment installed without such written consent shall be subject to removal by Landlord, at Tenant's sole risk and expense, without notice. Notwithstanding any contrary provision of this Lease, Tenant shall have no right to access the roof of the Premises or of the Building in which the Premises is located for any reason (including, without limitation, repair and maintenance obligations, installation and/or repair of communications systems, etc.) without the prior written consent of Landlord, which consent shall be conditioned upon, but not limited to (a) the prior approval by Landlord of Tenant’s plans for the installation, repair or maintenance of any equipment; (b) Tenant utilization of a contractor designated or approved by Landlord for all roof penetrations and access so as not to void any existing roof warranties; (c) Tenant maintenance of the area where roof penetrations or installations are made while Tenant’s equipment is present; (d) insuring the structural soundness of the roof; (e) the repair by Tenant of any damage to the roof caused by the making of roof penetrations or equipment installation, maintenance or repair, including, but not limited to, the repair of the roof penetrations upon the removal of any equipment installed thereon; (f) the coordination of the time and method of roof access, (g) the accompaniment by Landlord’s designated representative for such roof access. 13. Except as may be expressly permitted under the Lease, Tenant shall not affix or maintain upon the glass panes and supports of the show windows, entrance ways, doors, exterior walls or roof of the Premises any signs, advertising placards, names, insignia, trademarks, descriptive material or any other such like item or items except those which shall have first received the written approval of Landlord as to size, color, type, location, duration, copy, nature and display qualities. Tenant shall not affix, tape, place or maintain within the interior of the Premises any paper signs, cardboard signs, advertising placards, descriptive material or other such item or items that can be seen from the exterior of the Building, except those which shall have first received the written approval of Landlord as to form, size, type, color, location, duration, copy, nature and display qualities. EXHIBIT B – Page 3 Tenant shall not install or maintain any flashing, revolving, travelling, fiber optic or other lighting deemed distractive by Landlord anywhere within or upon the Premises. Landlord may, at Tenant's cost, remove any item erected in violation of this subsection. 14. The Premises shall not be used for housing, lodging or sleeping purposes or for any immoral or illegal purposes. 15. Tenant shall not place any furniture, accessories or other materials on any balconies located within or adjacent to the Premises without having obtained Landlord's express written approval thereof in each instance. 16. No sunscreen or other films shall be applied to the interior surface of any window glass. All glass, locks and trimmings in or upon the doors and windows of the Premises shall be kept whole, and when any part thereof shall be broken, the same shall be immediately replaced or repaired and put in order at Tenant's expense under the direction and to the satisfaction of Landlord, and shall be left whole and in good repair. 17. Open fires of any type are hereby prohibited. 18. The listing of the aforementioned items is not intended to be exclusive, but rather to indicate part of the scope and nature of the types of rules and regulations Landlord may impose. Landlord reserves the right, in its reasonable discretion and from time to time, to amend, alter, add and subtract from these rules and to make specific exceptions thereto. The Rules and Regulations set forth herein are intended to supplement the provisions of the Lease; in the event that any of the provisions of the Rules and Regulations conflict with the provisions of the Lease, the provisions of the Lease shall govern. EXHIBIT C - Page 1 EXHIBIT C COMMENCEMENT AND EXPIRATION DATE DECLARATION THIS COMMENCEMENT AND EXPIRATION DATE DECLARATION, made this _____ day of _____________, 20__, by and between NSHORE, LLC, a Florida limited liability company (herein “Landlord”), and ROSQUILLAS 2, LLC, a Florida limited liability company, (herein “Tenant”). W I T N E S S E T H: WHEREAS, Landlord and Tenant have entered into that certain lease dated _____________, 20__ (the “Lease”), for certain property located at 363 Atlantic Blvd, in Atlantic Beach, Duval County, Florida; and WHEREAS, Landlord and Tenant wish to set forth their agreements as to the commencement of the Term of the Lease. NOW, THEREFORE, Landlord and Tenant agree as follows (all capitalized terms shall have the same meanings herein as are attributed to such terms in the Lease): 1. The Term of the Lease commenced on June __, 2022. 2. The initial term of the Lease shall expire on November 30, 2027 3. Tenant has One (1) options of Five (5) years each as described in the lease. 4. The Commencement Date for purposes of paying rent under the Lease is December 1, 2022. 5. As of the Commencement Date, Rentable Area of the Premises: 2,017 square feet. 6. Rentable Area of the Building: 17,190 square feet 14th June 22 June 14th 22 14 EXHIBIT C - Page 2 IN WITNESS WHEREOF, Landlord and Tenant have signed and sealed this Commencement and Expiration Date Declaration as of the day and year first above written. LANDLORD: NSHORE, LLC, a Florida limited liability company ______________________________ By: Taraz N. Darabi Its: Manager TENANT: ROSQUILLAS 2, LLC, a Florida limited liability company, ___________________________ By: ____________________________ Its: ____________________________ EXHIBIT E – Page 1 EXHIBIT D Sign Criteria The intent of Landlord and the management is to create a graphic environment that is individual and distinctive in identity for the merchant and also compatible with other signs within the Shopping Center. The total concept should give an impression of quality, professionalism and instill a good business image. The following specifications are to be used for design of your sign; however, in all cases, final written approval is required from Landlord prior to manufacturing and installation of all signs, including any sign inside that may be invisible from the outside. Procedure: Sign drawing proposal will be submitted in two (2) copies to Landlord for written approval. One copy will be returned to Tenant or Tenant's Sign Company and one copy shall be retained in the lease file. Notice: Written approval and conformance with this specification does not imply conformance with local city and other applicable sign codes. Your sign must be permitted and must comply with all applicable electrical and local sign codes. A. Wording on large-scale signs shall be limited to store or trade name only. Each party’s customary signature or logo, hallmark, insignia, or other trade identification will he respected within the guidelines set forth. B. The size of all Tenant signs shall be limited. The scale and concept of the Shopping Center require the use of appropriate signage. Tenant’s sign shall be located on the designated sign panel within the limits of its storefront and shall not project more than 8” beyond the face of the sign panel. The letters shall be mounted to the sign fascia on the framing concealed in the sign panel construction. C. Tenant signs shall be individual channel-type letters only. Maximum height of the letters shall be 24” for capitals or logos and 16” for small letters. The total sign width shall be limited to 60% of Tenant frontage and shall in no case exceed a length of thirty feet. D. Sign letter shall be aluminum reverse channel frame (minimum .090) with flat aluminum face, mounted with concealed fasteners and white neon lighting. The channel frame shall be painted in a durodic bronze finish, trim cap color to be gold. All letters shall be illuminated with neon tubes powered by normal factor transformers installed in the letter. 120 volt circuit will be provided by Landlord/Contractor. All letters shall be approved by Landlord/Contractor. All letters shall be approved by Underwriter Laboratories and carry seal of approval. E. Except as otherwise approved in writing by Landlord, only one sign per Tenant will be permitted on the sign panel except the corner Tenant who may have two signs. F. Sign company names or stamps shall be concealed (Code permitting). G. Signs with exposed neon tubing, exposed lamps and signs of the flashing, blinking, rotating, moving or animated type or audible type are not permitted. H. Painted or printed signs on the exterior surface of any building shall be prohibited, except small-scale signs stating store hours, which are neatly lettered on the glass of the storefront, shall be permitted subject to Landlord’s approval; and, in addition, any non-customer door for receiving merchandise may have in two-inch (2”) block letters, the name of Tenant. I. Public safety decals or artwork on glass in minimum sizes to comply with applicable Code, subject to the approval of Landlord, may be used, as required by building codes EXHIBIT E – Page 2 or other governmental regulations. J. Paper signs, stickers, banners or flags are prohibited on the store windows, either interior or exterior, or on any exterior portion of the Shopping Center. K. No exposed raceways, ballast boxes or electrical transformers will be permitted except as required by Code. L. The following are not permitted: (1) Roof of box sings. (2) Cloth or banner signs hanging in front of the business or within the Premises so as to be visible from the exterior walk or parking lot. (3) Animated or moving components. (4) Intermittent or flashing illumination. (5) Iridescent painted signs. (6) Letters mounted or painted on illuminated panels. (7) Signs or letters painted directly on any surface except as herein provided. (8) Signs will not be permitted to be installed or placed along perimeter of Shopping Center. (9) Trailer signs or temporary signs. EXHIBIT E EXHIBIT E – Page 3 INTENTIONALLY DELETED EXHIBIT F – Page 1 EXHIBIT F INTENTIONALLY DELETED